product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
RPL11 cDNA Clone
catalog :
MBS1276408
quantity :
0.01 mg Plasmid + 0.
price :
165 USD
more info or order :
product information
catalog number :
MBS1276408
products type :
cDNA Clone
products full name :
RPL11 cDNA Clone
products short name :
RPL11
other names :
Homo sapiens ribosomal protein L11, mRNA; 60S ribosomal protein L11; 60S ribosomal protein L11; ribosomal protein L11; CLL-associated antigen KW-12
products gene name :
RPL11
other gene names :
RPL11; RPL11; L11; DBA7; GIG34
uniprot entry name :
RL11_HUMAN
sequence length :
611
sequence :
atggcggatcaaggtgaaaaggagaaccccatgcgggaa
cttcgcatccgcaaactctgtctcaacatctgtgttggg
gagagtggagacagactgacgcgagcagccaaggtgttg
gagcagctcacagggcagacccctgtgttttccaaagct
agatacactgtcagatcctttggcatccggagaaatgaa
aagattgctgtccactgcacagttcgaggggccaaggca
gaagaaatcttggagaagggtctaaaggtgcgggagtat
gagttaagaaaaaacaacttctcagatactggaaacttt
ggttttgggatccaggaacacatcgatctgggtatcaaa
tatgacccaagcattggtatctacggcctggacttctat
gtggtgctgggtaggccaggtttcagcatcgcagacaag
aagcgcaggacaggctgcattggggccaaacacagaatc
agcaaagaggaggccatgcgctggttccagcagaagtat
gatgggatcatccttcctggcaaataa
other info1 :
Vector: Please Inquire
ncbi gi num :
40226081
ncbi acc num :
BC018970
ncbi mol weight :
20,124 Da
ncbi pathways :
Cap-dependent Translation Initiation Pathway (105967); Cytoplasmic Ribosomal Proteins Pathway (198853); Disease Pathway (530764); Eukaryotic Translation Elongation Pathway (105976); Eukaryotic Translation Initiation Pathway (105966); Eukaryotic Translation Termination Pathway (105978); Formation Of A Pool Of Free 40S Subunits Pathway (105968); GTP Hydrolysis And Joining Of The 60S Ribosomal Subunit Pathway (105973); Gene Expression Pathway (105937); Influenza Infection Pathway (106067)
ncbi summary :
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
uniprot summary :
RPL11: Binds to 5S ribosomal RNA. Required for rRNA maturation and formation of the 60S ribosomal subunits. Promotes nucleolar location of PML. Defects in RPL11 are the cause of Diamond-Blackfan anemia type 7 (DBA7). DBA7 is a form of Diamond-Blackfan anemia, a congenital non-regenerative hypoplastic anemia that usually presents early in infancy. Diamond-Blackfan anemia is characterized by a moderate to severe macrocytic anemia, erythroblastopenia, and an increased risk of malignancy. 30 to 40% of Diamond-Blackfan anemia patients present with short stature and congenital anomalies, the most frequent being craniofacial (Pierre-Robin syndrome and cleft palate), thumb and urogenital anomalies. Belongs to the ribosomal protein L5P family. 2 isoforms of the human protein are produced by alternative splicing. Protein type: Motility/polarity/chemotaxis; Nucleolus; Ribosomal; Translation. Chromosomal Location of Human Ortholog: 1p36.1-p35. Cellular Component: cytoplasm; cytosol; extracellular matrix; membrane; nucleolus. Molecular Function: protein binding; RNA binding. Biological Process: mRNA catabolic process, nonsense-mediated decay; protein targeting; ribosomal large subunit assembly and maintenance; ribosomal large subunit biogenesis and assembly; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translational initiation; viral transcription. Disease: Diamond-blackfan Anemia 7
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price1 :
165 USD
more info or order :
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!