product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
TRPV6 cDNA Clone
catalog :
MBS1274228
quantity :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price :
165 USD
more info or order :
MyBioSource product webpage
product information
catalog number :
MBS1274228
products type :
cDNA Clone
products full name :
TRPV6 cDNA Clone
products short name :
[TRPV6]
other names :
[Homo sapiens transient receptor potential cation channel, subfamily V, member 6, mRNA; Transient receptor potential cation channel subfamily V member 6; transient receptor potential cation channel subfamily V member 6; transient receptor potential cation channel subfamily V member 6; CaT-like; CaT-L; Calcium transport protein 1; CaT1; Epithelial calcium channel 2; ECaC2]
products gene name :
[TRPV6]
other gene names :
[TRPV6; TRPV6; CAT1; CATL; ZFAB; ECAC2; ABP/ZF; LP6728; HSA277909; ECAC2; TrpV6; CaT-L; CaT1; ECaC2]
uniprot entry name :
TRPV6_HUMAN
sequence length :
321
sequence :
atgtacgttgagaatcactgctccaggcctgcattactc
cttcagctctggggcagaggaagcccagcccaagcacgg
ggctggcagggcgtgaggaactctcctgtggcctgctca
tcacccttccgacaggagcactgcatgtcagagcacttt
aaaaacaggccagcctgcttgggcgctcggtctccaccc
cagggtcataagtggggagagagcccttcccagggcacc
caggcaggtgcagggaagtgcagagcttgtggaaagcgt
gtgagtgagggagacaggaacggctctgggggtgggaag
tggggctag
other info1 :
Vector: pENTR223.1
other info2 :
Clone Sequence Report: Provided with product shipment
ncbi gi num :
21961317
ncbi acc num :
BC034814
ncbi mol weight :
68,446 Da
ncbi pathways :
Mineral Absorption Pathway (212237); Mineral Absorption Pathway (212220); Salivary Secretion Pathway (153376); Salivary Secretion Pathway (153352); Signaling Events Mediated By PTP1B Pathway (138017); TCR Signaling In Naive CD4+ T Cells Pathway (137998); TCR Signaling In Naive CD8+ T Cells Pathway (138055)
ncbi summary :
This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
uniprot summary :
TRPV6: Calcium selective cation channel probably involved in Ca(2+) uptake in various tissues, including Ca(2+) reabsorption in intestine. The channel is activated by low internal calcium level, probably including intracellular calcium store depletion, and the current exhibits an inward rectification. Inactivation includes both, a rapid Ca(2+)-dependent and a slower Ca(2+)-calmodulin- dependent mechanism, the latter may be regulated by phosphorylation. In vitro, is slowly inhibited by Mg(2+) in a voltage-independent manner. Heteromeric assembly with TRPV5 seems to modify channel properties. TRPV5-TRPV6 heteromultimeric concatemers exhibit voltage-dependent gating. Belongs to the transient receptor (TC 1.A.4) family. TrpV subfamily. TRPV6 sub-subfamily. 2 isoforms of the human protein are produced by alternative splicing. Protein type: Channel, calcium; Membrane protein, multi-pass; Membrane protein, integral. Chromosomal Location of Human Ortholog: 7q34. Cellular Component: integral to plasma membrane; plasma membrane. Molecular Function: calcium channel activity; calmodulin binding; protein binding. Biological Process: calcium ion transport
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price1 :
165 USD
more info or order :
MyBioSource product webpage
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!