product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
DYNC1H1 cDNA Clone
catalog :
MBS1273237
quantity :
10 ug Plasmid + 200
price :
175 USD
more info or order :
product information
catalog number :
MBS1273237
products type :
cDNA Clone
products full name :
DYNC1H1 cDNA Clone
products short name :
DYNC1H1
other names :
Homo sapiens dynein, cytoplasmic 1, heavy chain 1, mRNA; Cytoplasmic dynein 1 heavy chain 1; cytoplasmic dynein 1 heavy chain 1; dynein heavy chain, cytosolic; dynein, cytoplasmic, heavy polypeptide 1; dynein, cytoplasmic 1, heavy chain 1; Cytoplasmic dynein heavy chain 1; Dynein heavy chain, cytosolic
products gene name :
DYNC1H1
other gene names :
DYNC1H1; DYNC1H1; p22; DHC1; DNCL; DYHC; HL-3; DHC1a; DNCH1; DNECL; Dnchc1; DHC1; DNCH1; DNCL; DNECL; DYHC; KIAA0325
uniprot entry name :
DYHC1_HUMAN
sequence length :
1369
sequence :
atgatcagtaaaatgctgaagatgcagatgttggaggat
gaggacgacctggcctacgcagagaccgagaagaagacg
aggacagactccacgtccgacgggcgccctgcctggatg
cggacactgcacaccaccgcgtccaactggctgcacctc
atcccccagacgctgagccacctcaagcgcaccgtggag
aatatcaaggatcctttgttcaggttctttgagagagaa
gtgaagatgggcgcaaagctgcttcaggacgttcgccag
gaccttgcagatgtcgtccaggtgtgcgaaggaaagaag
aagcagaccaactacttgcgcacgctgatcaacgagcta
gtgaaagggatcttgcctcggagctggtcccactacacg
gtgcctgccggcatgaccgtcatccagtgggtgtccgac
ttcagcgagaggatcaaacagctgcagaacatctcactg
gcagctgcatctggtggcgccaaggagctaaaggtgaag
gcgctcctgacgagtctcgggtggtcagcagctgtcctg
ggctggggtgggagtggctctggggaaaaacacagggcc
caggtctga
other info1 :
Vector: pENTR223.1
ncbi gi num :
40352900
ncbi acc num :
BC064521
uniprot acc num :
Q14204
ncbi mol weight :
532,408 Da
ncbi pathways :
Adaptive Immune System Pathway 366160!!Cell Cycle Pathway 530733!!Cell Cycle, Mitotic Pathway 105765!!Centrosome Maturation Pathway 105807!!G2/M Transition Pathway 105801!!Immune System Pathway 106386!!Lissencephaly Gene (LIS1) In Neuronal Migration And Development Pathway 137984!!Loss Of Nlp From Mitotic Centrosomes Pathway 105811!!Loss Of Proteins Required For Interphase Microtubule Organization From The Centrosome Pathway 105810!!MHC Class II Antigen Presentation Pathway 645290
ncbi summary :
Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
uniprot summary :
Function: Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Subunit structure: Homodimer. The cytoplasmic dynein 1 complex consists of two catalytic heavy chains (HCs) and a number of non-catalytic subunits presented by intermediate chains (ICs), light intermediate chains (LICs) and light chains (LCs); the composition seems to vary in respect to the IC, LIC and LC composition. The heavy chain homodimer serves as a scaffold for the probable homodimeric assembly of the respective non-catalytic subunits. The ICs and LICs bind directly to the HC dimer and dynein LCs assemble on the IC dimer. Interacts with DYNC1LI1; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1LI2; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1I2 . By similarity. Subcellular location: Cytoplasm cytoskeleton. Domain: Dynein heavy chains probably consist of an N-terminal stem (which binds cargo and interacts with other dynein components), and the head or motor domain. The motor contains six tandemly-linked AAA domains in the head, which form a ring. A stalk-like structure (formed by two of the coiled coil domains) protrudes between AAA 4 and AAA 5 and terminates in a microtubule-binding site. A seventh domain may also contribute to this ring; it is not clear whether the N-terminus or the C-terminus forms this extra domain. There are four well-conserved and two non-conserved ATPase sites, one per AAA domain. Probably only one of these (within AAA 1) actually hydrolyzes ATP, the others may serve a regulatory function. Involvement in disease: Charcot-Marie-Tooth disease 2O (CMT2O) [MIM:614228]: An axonal form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Neuropathies of the CMT2 group are characterized by signs of axonal degeneration in the absence of obvious myelin alterations, normal or slightly reduced nerve conduction velocities, and progressive distal muscle weakness and atrophy. Nerve conduction velocities are normal or slightly reduced.Note: The disease is caused by mutations affecting the gene represented in this entry. Ref.15Mental retardation, autosomal dominant 13 (MRD13) [MIM:614563]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. MRD13 is associated with variable neuronal migration defects and mild dysmorphic features. Some patients may also show signs of peripheral neuropathy, such as abnormal gait and hyporeflexia.Note: The disease is caused by mutations affecting the gene represented in this entry. Ref.14 Ref.16Spinal muscular atrophy, lower extremity, autosomal dominant (SMALED) [MIM:158600]: A form of spinal muscular atrophy, a neuromuscular disorder characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMALED is characterized by muscle weakness predominantly affecting the proximal lower extremities.Note: The disease is caused by mutations affecting the gene represented in this entry. Ref.17 Ref.18. Sequence similarities: Belongs to the dynein heavy chain family. Sequence caution: The sequence BAA20783.3 differs from that shown. Reason: Erroneous initiation. Translation N-terminally shortened.
size :
10 ug Plasmid + 200 ul Glycerol Stock
price :
175 USD
more info or order :
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!