catalog number :
MBS1271847
products type :
cDNA Clone
products full name :
IL1B cDNA Clone
products short name :
IL1B
other names :
Homo sapiens interleukin 1, beta, mRNA; Interleukin-1 beta; interleukin-1 beta; interleukin 1 beta; Catabolin
products gene name :
IL1B
other gene names :
IL1B; IL1B; IL-1; IL1F2; IL1-BETA; IL1F2; IL-1 beta
uniprot entry name :
IL1B_HUMAN
sequence :
atggcagaagtacctgagctcgccagtgaaatgatggct
tattacagtggcaatgaggatgacttgttctttgaagct
gatggccctaaacagatgaagtgctccttccaggacctg
gacctctgccctctggatggcggcatccagctacgaatc
tccgaccaccactacagcaagggcttcaggcaggccgcg
tcagttgttgtggccatggacaagctgaggaagatgctg
gttccctgcccacagaccttccaggagaatgacctgagc
accttctttcccttcatctttgaagaagaacctatcttc
ttcgacacatgggataacgaggcttatgtgcacgatgca
cctgtacgatcactgaactgcacgctccgggactcacag
caaaaaagcttggtgatgtctggtccatatgaactgaaa
gctctccacctccagggacaggatatggagcaacaagtg
gtgttctccatgtcctttgtacaaggagaagaaagtaat
gacaaaatacctgtggccttgggcctcaaggaaaagaat
ctgtacctgtcctgcgtgttgaaagatgataagcccact
ctacagctggagagtgtagatcccaaaaattacccaaag
aagaagatggaaaagcgatttgtcttcaacaagatagaa
atcaataacaagctggaatttgagtctgcccagttcccc
aactggtacatcagcacctctcaagcagaaaacatgccc
gtcttcctgggagggaccaaaggcggccaggatataact
gacttcaccatgcaatttgtgtcttcctaa
other info1 :
Vector: Please Inquire
ncbi mol weight :
30,748 Da
ncbi pathways :
African Trypanosomiasis Pathway (194384); African Trypanosomiasis Pathway (194323); Alzheimer's Disease Pathway (83097); Alzheimer's Disease Pathway (509); Alzheimers Disease Pathway (672448); Amoebiasis Pathway (167324); Amoebiasis Pathway (167191); Apoptosis Pathway (83060); Apoptosis Pathway (470); Cellular Roles Of Anthrax Toxin Pathway (138076)
ncbi summary :
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2008]
uniprot summary :
IL1B: Produced by activated macrophages, IL-1 stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity. IL-1 proteins are involved in the inflammatory response, being identified as endogenous pyrogens, and are reported to stimulate the release of prostaglandin and collagenase from synovial cells. Monomer. Belongs to the IL-1 family. Protein type: Cytokine. Chromosomal Location of Human Ortholog: 2q14. Cellular Component: cytosol; extracellular region; extracellular space. Molecular Function: cytokine activity; interleukin-1 receptor binding; protein domain specific binding. Biological Process: activation of MAPK activity; activation of NF-kappaB transcription factor; apoptosis; cell-cell signaling; cytokine and chemokine mediated signaling pathway; embryo implantation; hyaluronan biosynthetic process; inflammatory response; lipopolysaccharide-mediated signaling pathway; MAPKKK cascade; negative regulation of cell proliferation; negative regulation of insulin receptor signaling pathway; negative regulation of lipid catabolic process; negative regulation of lipid metabolic process; negative regulation of MAP kinase activity; positive regulation of angiogenesis; positive regulation of fever; positive regulation of granulocyte macrophage colony-stimulating factor production; positive regulation of heterotypic cell-cell adhesion; positive regulation of interferon-gamma production; positive regulation of interleukin-2 biosynthetic process; positive regulation of interleukin-6 production; positive regulation of interleukin-8 production; positive regulation of JNK cascade; positive regulation of lipid catabolic process; positive regulation of membrane protein ectodomain proteolysis; positive regulation of mitosis; positive regulation of NF-kappaB import into nucleus; positive regulation of nitric oxide biosynthetic process; positive regulation of phagocytosis; positive regulation of prostaglandin secretion; positive regulation of protein amino acid phosphorylation; positive regulation of T cell mediated immunity; positive regulation of T cell proliferation; positive regulation of transcription factor activity; positive regulation of transcription, DNA-dependent; positive regulation of vascular endothelial growth factor receptor signaling pathway; protein kinase B signaling cascade; regulation of I-kappaB kinase/NF-kappaB cascade; regulation of insulin secretion; regulation of nitric-oxide synthase activity; sequestering of triacylglycerol; signal transduction. Disease: Gastric Cancer, Hereditary Diffuse
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock