product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
ZBP1 cDNA Clone
catalog :
MBS1271015
quantity :
0.01 mg Plasmid + 0.
price :
175 USD
more info or order :
MyBioSource product webpage
product information
catalog number :
MBS1271015
products type :
cDNA Clone
products full name :
ZBP1 cDNA Clone
products short name :
ZBP1
other names :
Homo sapiens Z-DNA binding protein 1, mRNA; Z-DNA-binding protein 1; Z-DNA-binding protein 1; DNA-dependent activator of IRFs; DNA-dependent activator of IFN-regulatory factors; tumor stroma and activated macrophage protein DLM-1; DNA-dependent activator of interferon regulatory factors; Z-DNA binding protein 1; Tumor stroma and activated macrophage protein DLM-1
products gene name :
ZBP1
other gene names :
ZBP1; ZBP1; DAI; DLM1; DLM-1; C20orf183; C20orf183; DLM1
uniprot entry name :
ZBP1_HUMAN
sequence length :
1800
sequence :
atggcccaggctcctgctgacccgggcagagaaggccac
cttgaacaaagaatcctgcaggtgctgacagaggctggc
tccccggtgaaacttgcccagctggtgaaggaatgccaa
gcacccaagagggagctcaaccaagtcctctaccgaatg
aaaaaggagttgaaagtctccctcacatcccctgccacc
tggtgcttgggcgggactgatcctgaaggcgagggtcct
gcagagctggccttgtccagccctggtaactgccacccc
ggggaggcgggtctgaccctgcagggagcatcctggcaa
tggacaagcacagatttgagcctgggttcgaatctgaac
tctgccacatgggagctcacaggtttcctctctctgtgc
cttggtttctttttctggttgatggagctcacagcaggg
ctgcttggtaggggttgctga
other info1 :
Vector: Please Inquire
ncbi gi num :
20380063
ncbi acc num :
BC028218
uniprot acc num :
Q9H171
ncbi mol weight :
46,343 Da
ncbi pathways :
Cytosolic DNA-sensing Pathway (125137); Cytosolic DNA-sensing Pathway (124833); Cytosolic Sensors Of Pathogen-associated DNA Pathway (576255); DAI Mediated Induction Of Type I IFNs Pathway (576256); IRF3 Mediated Activation Of Type 1 IFN Pathway (576257); Immune System Pathway (106386); Innate Immune System Pathway (106387); RIP-mediated NFkB Activation Via DAI Pathway (576258)
ncbi summary :
This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
uniprot summary :
ZBP1: Participates in the detection by the host s innate immune system of DNA from viral, bacterial or even host origin. Plays a role in host defense against tumors and pathogens. Acts as a cytoplasmic DNA sensor which, when activated, induces the recruitment of TBK1 and IRF3 to its C-terminal region and activates the downstream interferon regulatory factor (IRF) and NF-kappa B transcription factors, leading to type-I interferon production. ZBP1-induced NF-kappaB activation probably involves the recruitment of the RHIM containing kinases RIPK1 and RIPK3. 5 isoforms of the human protein are produced by alternative splicing. Protein type: Motility/polarity/chemotaxis; DNA-binding. Chromosomal Location of Human Ortholog: 20q13.31. Cellular Component: cytoplasm; nucleus; cytosol. Molecular Function: double-stranded RNA adenosine deaminase activity; protein binding; DNA binding; left-handed Z-DNA binding; RNA binding. Biological Process: metabolic process; positive regulation of interferon type I production; innate immune response
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price1 :
175 USD
more info or order :
MyBioSource product webpage
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!