product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
CAV2 cDNA Clone
catalog :
MBS1270622
quantity :
0.01 mg Plasmid + 0.
price :
165 USD
more info or order :
MyBioSource product webpage
product information
catalog number :
MBS1270622
products type :
cDNA Clone
products full name :
CAV2 cDNA Clone
products short name :
CAV2
other names :
Homo sapiens caveolin 2, mRNA; Caveolin-2; caveolin-2; caveolin 2
products gene name :
CAV2
other gene names :
CAV2; CAV2; CAV
uniprot entry name :
CAV2_HUMAN
sequence length :
1490
sequence :
atggggctggagacggagaaggcggacgtacagctcttc
atggacgacgactcctacagccaccacagcggcctcgag
tacgccgaccccgagaagttcgcggactcggaccaggac
cgggatccccaccggctcaactcgcatctcaagctgggc
ttcgaggatgtgatcgcagagccggtgactacgcactcc
tttgacaaagtgtggatctgcagccatgccctctttgaa
atcagcaaatacgtaatgtacaagttcctgacggtgttc
ctggccattcccctggccttcattgcgggaattctcttt
gccaccctcagctgtctgcacatctggattttaatgcct
tttgtaaagacctgcctaatggttctgccttcagtgcag
acaatatggaagagtgtgacagatgttatcattgctcca
ttgtgtacgagcgtaggacgatgcttctcttctgtcagc
ctgcaactgagccaggattga
other info1 :
Vector: Please Inquire
ncbi gi num :
13528926
ncbi acc num :
BC005256
ncbi mol weight :
12,780 Da
ncbi pathways :
Bacterial Invasion Of Epithelial Cells Pathway (149807); Bacterial Invasion Of Epithelial Cells Pathway (148661); EGFR1 Signaling Pathway (198782); Endocytosis Pathway (102279); Endocytosis Pathway (102181); Focal Adhesion Pathway (198795); Focal Adhesion Pathway (83067); Focal Adhesion Pathway (478); Integrin-mediated Cell Adhesion Pathway (198816); Proteoglycans In Cancer Pathway (782000)
ncbi summary :
The protein encoded by this gene is a major component of the inner surface of caveolae, small invaginations of the plasma membrane, and is involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. This gene and related family member (CAV1) are located next to each other on chromosome 7, and express colocalizing proteins that form a stable hetero-oligomeric complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell (PMID:11238462). [provided by RefSeq, May 2011]
uniprot summary :
Caveolin-2: a scaffolding protein. A component of caveolae, small invaginations of the plasma membrane found in most cell types. Involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. Interacts directly with G-protein alpha subunits and can functionally regulate their activity. Caveolin-2 may function as an accessory protein in conjunction with caveolin-1. Two splice-variant isoforms have been observed. Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis. Chromosomal Location of Human Ortholog: 7q31.1. Cellular Component: caveola; cytoplasmic vesicle; extrinsic to internal side of plasma membrane; focal adhesion; Golgi apparatus; integral to plasma membrane; intracellular; lipid raft; perinuclear region of cytoplasm; plasma membrane; protein complex; transport vesicle. Molecular Function: protein binding; protein homodimerization activity. Biological Process: endoplasmic reticulum organization and biogenesis; insulin receptor signaling pathway; mitochondrion organization and biogenesis; negative regulation of endothelial cell proliferation; positive regulation of dopamine receptor signaling pathway; positive regulation of GTPase activity; positive regulation of MAPKKK cascade; receptor mediated endocytosis of virus by host; regulation of mitosis; skeletal muscle fiber development; vesicle docking; vesicle fusion; vesicle organization and biogenesis
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price1 :
165 USD
more info or order :
MyBioSource product webpage
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!