product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
LMX1A cDNA Clone
catalog :
MBS1269750
quantity :
0.01 mg Plasmid + 0.
price :
165 USD
more info or order :
MyBioSource product webpage
product information
catalog number :
MBS1269750
products type :
cDNA Clone
products full name :
LMX1A cDNA Clone
products short name :
LMX1A
other names :
Homo sapiens LIM homeobox transcription factor 1, alpha, mRNA; LIM homeobox transcription factor 1-alpha; LIM homeobox transcription factor 1-alpha; LIM homeobox transcription factor 1 alpha; LIM/homeobox protein 1.1; LMX-1.1; LIM/homeobox protein LMX1A
products gene name :
LMX1A
other gene names :
LMX1A; LMX1A; LMX1; LMX1.1; LMX-1.1
uniprot entry name :
LMX1A_HUMAN
sequence length :
1268
sequence :
atggaaggaatcatgaacccctacacggctctgcccacc
ccacagcagctcctggccatcgagcagagtgtctacagc
tcagatcccttccgacagggtctcaccccaccccagatg
cctggagaccacatgcacccttatggtgccgagcccctt
ttccatgacctggatagcgacgacacctccctcagtaac
ctgggtgactgtttcctagcaacctcagaagctgggcct
ctgcagtccagagtgggaaaccccattgaccatctgtac
tccatgcagaattcttacttcacatcttga
other info1 :
Vector: Please Inquire
ncbi gi num :
42490860
ncbi acc num :
BC066353
ncbi mol weight :
14,615 Da
ncbi summary :
This gene encodes a homeodomain and LIM-domain containing protein. The encoded protein is a transcription factor that acts as a positive regulator of insulin gene transcription. This gene also plays a role in the development of dopamine producing neurons during embryogenesis. Mutations in this gene are associated with an increased risk of developing Parkinson's disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
uniprot summary :
LMX1A: Acts as a transcriptional activator by binding to an A/T-rich sequence, the FLAT element, in the insulin gene promoter. Required for development of the roof plate and, in turn, for specification of dorsal cell fates in the CNS and developing vertebrae. 2 isoforms of the human protein are produced by alternative splicing. Protein type: DNA-binding; Cell development/differentiation; Motility/polarity/chemotaxis; Transcription factor. Chromosomal Location of Human Ortholog: 1q24.1. Molecular Function: protein binding. Biological Process: positive regulation of transcription from RNA polymerase II promoter
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price1 :
165 USD
more info or order :
MyBioSource product webpage
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!