catalog number :
MBS1268569
products type :
cDNA Clone
products full name :
MUC1 cDNA Clone
products short name :
MUC1
other names :
Homo sapiens mucin 1, cell surface associated, mRNA; Mucin-1; mucin-1; mucin 1, cell surface associated; Breast carcinoma-associated antigen DF3; Cancer antigen 15-3; CA 15-3
products gene name :
MUC1
other gene names :
MUC1; MUC1; EMA; MCD; PEM; PUM; KL-6; MAM6; MCKD; PEMT; CD227; H23AG; MCKD1; MUC-1; ADMCKD; ADMCKD1; CA 15-3; MUC-1/X; MUC1/ZD; MUC-1/SEC; PUM; MUC-1; CA 15-3; KL-6; PUM; PEM; EMA; MUC1-NT; MUC1-alpha; MUC1-beta
uniprot entry name :
MUC1_HUMAN
sequence :
ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTG
CTCCTCACAGTGCTTACAGCTACCACAGCCCCTAAACCC
GCAACAGTTGTTACGGGTTCTGGTCATGCAAGCTCTACC
CCAGGTGGAGAAAAGGAGACTTCGGCTACCCAGAGAAGT
TCAGTGCCCAGCTCTACTGAGAAGAATGCTTTTAATTCC
TCTCTGGAAGATCCCAGCACCGACTACTACCAAGAGCTG
CAGAGAGACATTTCTGAAATGTTTTTGCAGATTTATAAA
CAAGGGGGTTTTCTGGGCCTCTCCAATATTAAGTTCAGG
CCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGA
GAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTC
AATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTG
ACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCT
TTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGC
ATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTG
GCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGC
CGCCGAAAGAACTACGGGCAGCTGGACATCTTTCCAGCC
CGGGATACCTACCATCCTATGAGCGAGTACCCCACCTAC
CACACCCATGGGCGCTATGTGCCCCCTAGCAGTACCGAT
CGTAGCCCCTATGAGAAGGTTTCTGCAGGTAATGGTGGC
AGCAGCCTCTCTTACACAAACCCAGCAGTGGCAGCCACT
TCTGCCAACTTGTAG
other info1 :
Vector: Please Inquire
ncbi mol weight :
28,297 Da
ncbi pathways :
IL-7 Signaling Pathway (198857); Metabolism Of Proteins Pathway (106230); O-linked Glycosylation Of Mucins Pathway (530747); Post-translational Protein Modification Pathway (161012); Termination Of O-glycan Biosynthesis Pathway (530748)
ncbi summary :
This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
uniprot summary :
MUC1: a large cell surface glycoprotein expressed by most glandular and ductal epithelial cells and some hematopoietic cell lineages. Plays a role in adhesion and cell-cell interactions, metastasis and signaling. May provide a protective layer on epithelial surfaces. Direct or indirect interaction with actin cytoskeleton. Its cytoplasmic tail (MUC1CT) is involved in several signaling pathways, including those involving Ras, beta-catenin, p120 catenin, p53 and estrogen receptor alpha. MUC1CT also forms complexes with transcription factors, and then translocates to the nucleus by an unknown mechanism, where it is believed to influence the transcription of their target genes. MUC1CT has also been proposed to localize to mitochondrial membranes under conditions of genotoxic stress, where it attenuates the apoptotic pathway in response and confers resistance to apoptosis-inducing drugs. Aberrantly glycosylated forms expressed in human epithelial tumors, such as breast or ovarian cancer and also in non-epithelial tumor cells. Nine alternatively spliced isoforms have been described. Isoforms 5 and 9 are secreted. Isoform 7, expressed only in tumor cells, is a receptor and binds the secreted isoform 5. The binding induces the phosphorylation of the isoform 7, alters cellular morphology and initiates cell signaling. Can bind to GRB2 adapter protein. Protein type: Actin-binding; Cell adhesion; Membrane protein, integral; Nuclear receptor co-regulator; Motility/polarity/chemotaxis; Tumor suppressor. Chromosomal Location of Human Ortholog: 1q21. Cellular Component: extracellular space; Golgi lumen; integral to plasma membrane; nuclear chromatin; vesicle. Molecular Function: p53 binding; protein binding; transcription cofactor activity. Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator; negative regulation of cell adhesion mediated by integrin; O-glycan processing; regulation of transcription from RNA polymerase II promoter in response to stress. Disease: Medullary Cystic Kidney Disease 1
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock