product summary
Loading...
company name :
MyBioSource
product type :
cDNA
product name :
PYCR1 cDNA Clone
catalog :
MBS1266693
quantity :
0.01 mg Plasmid + 0.
price :
175 USD
more info or order :
MyBioSource product webpage
product information
catalog number :
MBS1266693
products type :
cDNA Clone
products full name :
PYCR1 cDNA Clone
products short name :
PYCR1
other names :
Homo sapiens pyrroline-5-carboxylate reductase 1, mRNA; Pyrroline-5-carboxylate reductase 1, mitochondrial; pyrroline-5-carboxylate reductase 1, mitochondrial; P5CR 1; P5C reductase 1; proliferation-inducing protein 45; mitochondrial pyrroline-5-carboxylate reductase 1; pyrroline-5-carboxylate reductase 1
products gene name :
PYCR1
other gene names :
PYCR1; PYCR1; P5C; P5CR; PRO3; PYCR; PIG45; PP222; ARCL2B; ARCL3B; P5C reductase 1; P5CR 1
uniprot entry name :
P5CR1_HUMAN
sequence length :
1757
sequence :
CTGGCCCCAGCGGGCAAGGATTGA
ATGGAGCAGCTGCTGAGCAGCGTGGGCTTCTGCACGGAG
GTGGAAGAGGACCTGATTGATGCCGTCACGGGGCTCAGT
GGCAGCGGCCCCGCCTACGCATTCACAGCCCTGGATGCC
CTGGCTGATGGGGGTGTGAAGATGGGACTTCCAAGGCGC
CTGGCAGTCCGCCTCGGGGCCCAGGCCCTCCTGGGGGCT
GCCAAGATGCTGCTGCACTCAGAACAGCACCCAGGCCAG
CTCAAGGACAACGTCAGCTCTCCTGGTGGGGCCACCATC
CATGCCTTGCATGTGCTGGAGAGTGGGGGCTTCCGCTCC
CTGCTCATCAACGCTGTGGAGGCCTCCTGCATCCGCACA
CGGGAGCTGCAGTCCATGGCTGACCAGGAGCAGGTGTCA
CCAGCCGCCATCAAGAAGACCATCCTGGACAAGGTGAAG
CTGGACTCCCCTGCAGGGACCGCTCTGTCGCCTTCTGGC
CACACCAAGCTGCTCCCCCGCAGC
other info1 :
Vector: Please Inquire
products description :
Homo sapiens pyrroline-5-carboxylate reductase 1, mRNA (cDNA clone ), complete cds.
ncbi gi num :
18490812
ncbi acc num :
BC022244
uniprot acc num :
P32322
ncbi mol weight :
33,361 Da
ncbi pathways :
Amino Acid Synthesis And Interconversion (transamination) Pathway (106173); Arginine And Proline Metabolism Pathway (82957); Arginine And Proline Metabolism Pathway (323); Biosynthesis Of Amino Acids Pathway (790012); Biosynthesis Of Amino Acids Pathway (795174); Metabolism Pathway (477135); Metabolism Of Amino Acids And Derivatives Pathway (106169); Proline Biosynthesis, Glutamate = Proline Pathway (413349); Proline Biosynthesis, Glutamate = Proline Pathway (468208); Urea Cycle And Metabolism Of Amino Groups Pathway (198758)
ncbi summary :
This gene encodes an enzyme that catalyzes the NAD(P)H-dependent conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
uniprot summary :
PYCR1: Housekeeping enzyme that catalyzes the last step in proline biosynthesis. Can utilize both NAD and NADP, but has higher affinity for NAD. Involved in the cellular response to oxidative stress. Defects in PYCR1 are the cause of cutis laxa autosomal recessive type 2B (ARCL2B). A multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin with reduced elasticity, joint laxity, craniofacial dysmorphic features, intrauterine growth retardation with some degree of postnatal growth deficiency, and developmental delay. Defects in PYCR1 are the cause of cutis laxa, autosomal recessive, type 3B (ARCL3B). ARCL3B is a disorder characterized by an aged appearance with distinctive facial features, sparse hair, ophthalmologic abnormalities, intrauterine growth retardation, and cutis laxa. Belongs to the pyrroline-5-carboxylate reductase family. Protein type: Mitochondrial; Oxidoreductase; Amino Acid Metabolism - arginine and proline; EC 1.5.1.2. Chromosomal Location of Human Ortholog: 17q25.3. Cellular Component: mitochondrion; mitochondrial matrix. Molecular Function: identical protein binding; protein binding; pyrroline-5-carboxylate reductase activity. Biological Process: regulation of mitochondrial membrane potential; proline biosynthetic process; amino acid biosynthetic process. Disease: Cutis Laxa, Autosomal Recessive, Type Iib; Cutis Laxa, Autosomal Recessive, Type Iiib
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock
price1 :
175 USD
more info or order :
MyBioSource product webpage
company information
MyBioSource
P.O. Box 153308
San Diego, CA 92195-3308
sales@mybiosource.com
https://www.mybiosource.com
1-888-627-0165
headquarters: USA
MyBioSource, LLC was orginally founded in Vancouver by three enthusiastic scientists who are passionate about providing the world with the best reagents available. Together, they form a company with a big vision known as MyBioSource. MyBioSource is now located in San Diego, California, USA.

"MyBioSource's number 1 vision is to be the world's number 1 quality reagents provider."

Our goal is to provide researchers, scientists and customers alike with a one-stop-shop for all of their reagents needs, whether it is monoclonal antibody, polyclonal antibody, recombinant protein, peptide, etc...

"MyBioSource offers the best products at unbeatable prices."

Please spend a few minutes to browse our online catalogs and see the wide range of products available. We ship our products through our shipping/distribution facility in San Diego, California, USA.

Would you like to receive email and e-newsletter from MyBioSource about new products, special offers and events? Please click here to join our Mailing List!