catalog number :
MBS1265664
products type :
cDNA Clone
products full name :
ANGPT1 cDNA Clone
products short name :
ANGPT1
other names :
Homo sapiens angiopoietin 1, mRNA; Angiopoietin-1; angiopoietin-1; angiopoietin 1
products gene name :
ANGPT1
other gene names :
ANGPT1; ANGPT1; AGP1; AGPT; ANG1; KIAA0003; ANG-1
uniprot entry name :
ANGP1_HUMAN
sequence :
atggacacagtccacaaccttgtcaatctttgcactaaa
gaagttttactaaagggaggaaaaagagaggaagagaaa
ccatttagagactgtgcagatgtatatcaagctggtttt
aataaaagtggaatctacactatttatattaataatatg
ccagaacccaaaaaggtgttttgcaatatggatgtcaat
gggggaggttggactgtaatacaacatcgtgaagatgga
agtctagatttccaaagaggctggaaggaatataaaatg
ggttttggaaatccctccggtgaatattggctggggaat
gagtttatttttgccattaccagtcagaggcagtacatg
ctaagaattgagttaatggactgggaagggaaccgagcc
tattcacagtatgacagattccacataggaaatgaaaag
caaaactataggtaa
other info1 :
Vector: Please Inquire
ncbi mol weight :
57,456 Da
ncbi pathways :
Angiogenesis Pathway (198772); Angiopoietin Receptor Tie2-mediated Signaling Pathway (137917); Cell Surface Interactions At The Vascular Wall Pathway (106062); HIF-1 Signaling Pathway (695200); Hemostasis Pathway (106028); PI3K-Akt Signaling Pathway (692234); PI3K-Akt Signaling Pathway (692979); Rheumatoid Arthritis Pathway (200309); Rheumatoid Arthritis Pathway (200269); Tie2 Signaling Pathway (106063)
ncbi summary :
This gene encodes a secreted glycoprotein that belongs to the angiopoietin family. Members of this family play important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The protein encoded by this gene is a secreted glycoprotein that activates the receptor by inducing its tyrosine phosphorylation. It plays a critical role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme and inhibits endothelial permeability. The protein also contributes to blood vessel maturation and stability, and may be involved in early development of the heart. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
uniprot summary :
ANGPT1: Binds and activates TEK/TIE2 receptor by inducing its dimerization and tyrosine phosphorylation. Plays an important role in the regulation of angiogenesis, endothelial cell survival, proliferation, migration, adhesion and cell spreading, reorganization of the actin cytoskeleton, but also maintenance of vascular quiescence. Required for normal angiogenesis and heart development during embryogenesis. After birth, activates or inhibits angiogenesis, depending on the context. Inhibits angiogenesis and promotes vascular stability in quiescent vessels, where endothelial cells have tight contacts. In quiescent vessels, ANGPT1 oligomers recruit TEK to cell-cell contacts, forming complexes with TEK molecules from adjoining cells, and this leads to preferential activation of phosphatidylinositol 3-kinase and the AKT1 signaling cascades. In migrating endothelial cells that lack cell-cell adhesions, ANGT1 recruits TEK to contacts with the extracellular matrix, leading to the formation of focal adhesion complexes, activation of PTK2/FAK and of the downstream kinases MAPK1/ERK2 and MAPK3/ERK1, and ultimately to the stimulation of sprouting angiogenesis. Mediates blood vessel maturation/stability. Implicated in endothelial developmental processes later and distinct from that of VEGF. Appears to play a crucial role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme. Protein type: Secreted; Secreted, signal peptide. Chromosomal Location of Human Ortholog: 8q23.1. Cellular Component: extracellular region; extracellular space; lipid raft; microvillus; plasma membrane. Molecular Function: Ras guanyl-nucleotide exchange factor activity; receptor tyrosine kinase binding. Biological Process: heparin biosynthetic process; leukocyte migration; MAPKKK cascade; negative regulation of apoptosis; negative regulation of cell adhesion; negative regulation of vascular permeability; positive chemotaxis; positive regulation of blood vessel endothelial cell migration; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of protein kinase B signaling cascade; positive regulation of protein ubiquitination; positive regulation of receptor internalization; regulation of endothelial cell proliferation; regulation of satellite cell proliferation; sprouting angiogenesis; Tie receptor signaling pathway; transmembrane receptor protein tyrosine kinase activation (dimerization)
size1 :
0.01 mg Plasmid + 0.2 mL Glycerol-Stock