product summary
request information :
company name :
GeneCopoeia
product type :
cDNA
product name :
Precursor miRNA clones for Mus musculus mir-2144 stem-loop with eGFP reporter gene
catalog :
MmiR3571-MR04
quantity :
price :
$247
more info or order :
product information
Catalog Number :
MmiR3571-MR04
Description :
Precursor miRNA clones for Mus musculus mir-2144 stem-loop with eGFP reporter gene
Promoter :
CMV
Selection Marker :
Puromycin
Reporter Gene :
eGFP
Vector :
pEZX-MR04
Precursor miRNA Name :
--2144
Precursor miRNA Accession :
MI0010759
Price ($) :
$247
Precursor Sequence :
guggaaugcgagugccuagugggccacuuuugguaagca
gaacuggcgcugcgggaugaaccgaacuauga
gaacuggcgcugcgggaugaaccgaacuauga
more info or order :
company information

GeneCopoeia
9620 Medical Center Drive
Rockville, MD 20850
Rockville, MD 20850
inquiry@genecopoeia.com
www.genecopoeia.com1-301-762-0888
headquarters: USA
GeneCopoeia offers the largest collection of expression-ready ORF cDNA, shRNA and miRNA clones. Available in a wide collection of lentiviral and non-viral expression vectors with a variety of fusion tags and reporters including fluorescent, solubility, purification and multi-functional tags. Explore the fully sequenced and expression-ready clone collections here.
Pre-validated gene-specific and miRNA qPCR primers are also available with reaction master mix reagents for quantitative analyses of gene or miRNA specific expression. SYBR Green® based qPCR mix kits together with pre-validated primers provide universal qPCR reaction conditions and robust qPCR data. Learn more about qPCR mix and primers.
Save time and publish faster on the GeneCopoeia Expressway to Discovery& number 8482;.
browse more products
- Precursor miRNA clones for Mus musculus mir-2145-1 stem-loop with eGFP reporter ...
- Precursor miRNA clones for Mus musculus mir-2145-2 stem-loop with eGFP reporter ...
- Precursor miRNA clones for Mus musculus mir-2145-2 stem-loop with eGFP reporter ...
- Precursor miRNA clones for Mus musculus mir-2146 stem-loop with eGFP reporter ge ...
- Precursor miRNA clones for Mus musculus mir-2146 stem-loop with eGFP reporter ge ...
- Precursor miRNA clones for Mus musculus mir-2182 stem-loop with eGFP reporter ge ...
- Precursor miRNA clones for Mus musculus mir-2182 stem-loop with eGFP reporter ge ...
- Precursor miRNA clones for Mus musculus mir-2183 stem-loop with eGFP reporter ge ...
questions and comments
