This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
GeneCopoeia
product type :
other
product name :
Validated miRNA qPCR primers against hsa-miR-32
catalog :
HmiRQP0404
price :
118.00 USD
citations: 1
| Reference |
|---|
Liao H, Xiao Y, Hu Y, Xiao Y, Yin Z, Liu L. microRNA-32 induces radioresistance by targeting DAB2IP and regulating autophagy in prostate cancer cells. Oncol Lett. 2015;10:2055-2062 pubmed
|
product information
Catalog# :
HmiRQP0404
Product Description :
Validated miRNA qPCR primers against hsa-miR-32
Precursor miRNA Name :
hsa-mir-32
Precursor miRNA Accession :
MI0000090
Mature miRNA Accession :
MIMAT0000090
Mature miRNA Name :
hsa-miR-32
Mature miRNA Sequence :
uauugcacauuacuaaguugca
List Price :
118.00 USD
company information

GeneCopoeia
9620 Medical Center Drive
Rockville, MD 20850
Rockville, MD 20850
inquiry@genecopoeia.com
www.genecopoeia.com1-301-762-0888
headquarters: USA
GeneCopoeia offers the largest collection of expression-ready ORF cDNA, shRNA and miRNA clones. Available in a wide collection of lentiviral and non-viral expression vectors with a variety of fusion tags and reporters including fluorescent, solubility, purification and multi-functional tags. Explore the fully sequenced and expression-ready clone collections here.
Pre-validated gene-specific and miRNA qPCR primers are also available with reaction master mix reagents for quantitative analyses of gene or miRNA specific expression. SYBR Green® based qPCR mix kits together with pre-validated primers provide universal qPCR reaction conditions and robust qPCR data. Learn more about qPCR mix and primers.
Save time and publish faster on the GeneCopoeia Expressway to Discovery& number 8482;.
questions and comments
