product summary
Loading...
company name :
Agrisera
product type :
protein
product name :
LexA LexA repressor (protein, positive control)
catalog :
AS21 4541P
quantity :
20 µg
price :
473.00 USD
more info or order :
product information
Catalog Number :
AS21 4541P
Product Name :
LexA LexA repressor (protein, positive control)
Product Type :
Blocking/control
Size :
20 µg
List Price :
473.00 USD
list of Pubmed id :
P0A7C2
Product Description :
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Background :
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Purity :
Contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90% pure by SDS-PAGE.
Uses :
Western blot (WB)
Application Summary :
Western blot (WB)
Storage :
Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
more info or order :
company information

Agrisera
Agrisera is a Swedish company specializing in polyclonal and monoclonal antibody production, offering primary and secondary antibodies off-the-shelf. Agrisera offers an extensive list of antibodies suitable for detection of plant and algal proteins in a wide range of research areas and applications. They are reactive in thousands of plant and algal species and cited in thousands of scientific articles. Agrisera was awarded as the Plant Science Antibody Supplier of the Year by CiteAB for the company with the most antibody citations for research related to plant science during 2018.
related products
browse more products
questions and comments
