This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
1037 pGL3 FasL promoter
catalog :
9028
citations: 2
| Reference |
|---|
Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers W. Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Mol Cell Biol. 2000;20:8969-82 pubmed
|
product information
Catalog Number :
9028
Product Name :
1037 pGL3 FasL promoter
article :
| doi | 10.1128/MCB.20.23.8969-8982.2000 |
| id | 353 |
| pubmed_id | 11073996 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pGL3 promoter | ||
| backbone_mutation | |||
| backbone_origin | |||
| backbone_size | 5010 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
and 5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were phosphorylated, annealed, and ligated to pGL3-promoter restricted with BglII and NheI to give pGL3-promoter-FasL.
5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTAT
TTAAATAAATAAGTAAATAAATAAAC-3'
Oligonucleotides
5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTAT
TTAAATAAATAAGTAAATAAATAAAC-3'
Oligonucleotides
origin :
37
pi :
|
resistance markers :
| 455 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
