This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pET22-His-TEV-DOT1L
catalog :
89610
citations: 1
Reference
Ipsaro J, Shen C, Arai E, Xu Y, Kinney J, Joshua Tor L, et al. Rapid generation of drug-resistance alleles at endogenous loci using CRISPR-Cas9 indel mutagenesis. PLoS ONE. 2017;12:e0172177 pubmed publisher
product information
Catalog Number :
89610
Product Name :
pET22-His-TEV-DOT1L
article :
doiPONE-D-16-48894 [pii]
id25272
pubmed_id28231254
bacterial resistance :
Ampicillin
cloning :
backbonepET-22
backbone_mutation
backbone_originNovagen
backbone_size5346
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
growth strain :
Bacterial expression vector for an N-terminally His-tagged (TEV-cleavable) version of human Dot1L residues 1-416
origin :
37
pi :
alt_names
Histone-lysine N-methyltransferase, H3 lysine-79 specific
DOT1-like protein
Lysine N-methyltransferase 4
cloning
clone_methodLigation Independent Cloning
cloning_site_3
cloning_site_5
promoterT7
sequencing_primer_3GCTAGTTATTGCTCAGCGG
sequencing_primer_5TAATACGACTCACTATAGGG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesDOT1, KMT4
geneDOT1L
id84444
genbank_ids
AF509504
mutation
nameDot1L
shRNA_sequence
size1293
species
9606
Homo sapiens
tags
locationN terminal on backbone
tagHis-TEV
resistance markers :
3340
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA