This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl F
catalog :
89375
citations: 1
Reference
Pérez Rico Y, Boeva V, Mallory A, Bitetti A, Majello S, Barillot E, et al. Comparative analyses of super-enhancers reveal conserved elements in vertebrate genomes. Genome Res. 2017;27:259-268 pubmed publisher
product information
Catalog Number :
89375
Product Name :
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl F
article :
doi10.1101/gr.203679.115
id25169
pubmed_id27965291
bacterial resistance :
Chloramphenicol and Ampicillin
cloning :
backboneE1b-GFP-Tol2-Gateway
backbone_mutation
backbone_originNadav Ahituv lab
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
growth strain :
Vector for reporter assay of one mouse super-enhancer region
origin :
37
pi :
alt_names
super-enhancer Irf2bpl
cloning
clone_methodGibson Cloning
cloning_site_3
cloning_site_5
promoter
sequencing_primer_3GTGCTTGTCGTACAGTTCGC
sequencing_primer_5GCCGCTTGCCACCATGTT
site_3_destroyed
site_5_destroyed
entrez_gene
aliases6430527G18Rik, Eap1
geneIrf2bpl
id238330
genbank_ids
mutation
nameIrf2bpl
shRNA_sequence
size3234
species
10090
Mus musculus
tags
resistance markers :
3320
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA