This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
lentiMPH v2
catalog :
89308
citations: 48
Reference
Weng L, Tang W, Wang X, Gong Y, Liu C, Hong N, et al. Surplus fatty acid synthesis increases oxidative stress in adipocytes and lnduces lipodystrophy. Nat Commun. 2024;15:133 pubmed publisher
Zhang G, Jiang P, Tang W, Wang Y, Qiu F, An J, et al. CPT1A induction following epigenetic perturbation promotes MAVS palmitoylation and activation to potentiate antitumor immunity. Mol Cell. 2023;83:4370-4385.e9 pubmed publisher
Yan G, Dai M, Poulet S, Wang N, Boudreault J, Daliah G, et al. Combined in vitro/in vivo genome-wide CRISPR screens in triple negative breast cancer identify cancer stemness regulators in paclitaxel resistance. Oncogenesis. 2023;12:51 pubmed publisher
Khaleafi R, Železnjak J, Cordela S, Drucker S, Rovis T, Jonjic S, et al. Reovirus infection of tumor cells reduces the expression of NKG2D ligands, leading to impaired NK-cell cytotoxicity and functionality. Front Immunol. 2023;14:1231782 pubmed publisher
Alborzinia H, Chen Z, Yildiz U, Freitas F, Vogel F, Varga J, et al. LRP8-mediated selenocysteine uptake is a targetable vulnerability in MYCN-amplified neuroblastoma. EMBO Mol Med. 2023;:e18014 pubmed publisher
Wong S, Tey S, Mao X, Fung H, Xiao Z, Wong D, et al. Small Extracellular Vesicle-Derived vWF Induces a Positive Feedback Loop between Tumor and Endothelial Cells to Promote Angiogenesis and Metastasis in Hepatocellular Carcinoma. Adv Sci (Weinh). 2023;10:e2302677 pubmed publisher
Cheng F, Ji Q, Wang L, Wang C, Liu G, Wang L. Reducing oxidative protein folding alleviates senescence by minimizing ER-to-nucleus H2 O2 release. EMBO Rep. 2023;:e56439 pubmed publisher
Collora J, Ho Y. Integration site-dependent HIV-1 promoter activity shapes host chromatin conformation. Genome Res. 2023;33:891-906 pubmed publisher
Gordon E, Wright C, James M, Cooper S. Transcriptomic and functional analysis of ANGPTL4 overexpression in pancreatic cancer nominates targets that reverse chemoresistance. BMC Cancer. 2023;23:524 pubmed publisher
Zhang H, Yan J, Lu Z, Zhou Y, Zhang Q, Cui T, et al. Deep sampling of gRNA in the human genome and deep-learning-informed prediction of gRNA activities. Cell Discov. 2023;9:48 pubmed publisher
Sun G, Zheng Y, Fu X, Zhang W, Ren J, Ma S, et al. Single-cell transcriptomic atlas of mouse cochlear aging. Protein Cell. 2023;14:180-201 pubmed publisher
W xfc nnemann F, Fotsing Tadjo T, Beaudoin M, Lalonde S, Lo K, Kleinstiver B, et al. Multimodal CRISPR perturbations of GWAS loci associated with coronary artery disease in vascular endothelial cells. PLoS Genet. 2023;19:e1010680 pubmed publisher
Wang Y, Zhao Y, Guo W, Yadav G, Bhaskarla C, Wang Z, et al. Genome-wide gain-of-function screening characterized lncRNA regulators for tumor immune response. Sci Adv. 2022;8:eadd0005 pubmed publisher
Tatsumi A, Hirakochi H, Inoue S, Tanaka Y, Furuno H, Ikeda M, et al. Identification of NRAS Downstream Genes with CRISPR Activation Screening. Biology (Basel). 2022;11: pubmed publisher
Koyanagi A, Onishi I, Muraoka K, Sato I, Sato S, Kimura T, et al. Identification of the Factor That Leads Human Mesenchymal Stem Cell Lines into Decellularized Bone. Bioengineering (Basel). 2022;9: pubmed publisher
Rebsamen M, Girardi E, Sedlyarov V, Scorzoni S, Papakostas K, Vollert M, et al. Gain-of-function genetic screens in human cells identify SLC transporters overcoming environmental nutrient restrictions. Life Sci Alliance. 2022;5: pubmed publisher
Dale K, Armond J, Hynds R, Vladimirou E. Modest increase of KIF11 expression exposes fragilities in the mitotic spindle, causing chromosomal instability. J Cell Sci. 2022;135: pubmed publisher
Tanaka Y, Kambayashi H, Yamamoto A, Onishi I, Sugita K, Matsumura M, et al. Efficient Identification of the MYC Regulator with the Use of the CRISPR Library and Context-Matched Database Screenings. Int J Mol Sci. 2022;23: pubmed publisher
Dorado Garc xed a H, Pusch F, Bei Y, von Stebut J, Ib xe1 xf1 ez G, Guillan K, et al. Therapeutic targeting of ATR in alveolar rhabdomyosarcoma. Nat Commun. 2022;13:4297 pubmed publisher
Le Nabec A, Blotas C, Briset A, Collobert M, Ferec C, Moisan S. 3D Chromatin Organization Involving MEIS1 Factor in the cis-Regulatory Landscape of GJB2. Int J Mol Sci. 2022;23: pubmed publisher
Omachi K, Miner J. Comparative analysis of dCas9-VP64 variants and multiplexed guide RNAs mediating CRISPR activation. PLoS ONE. 2022;17:e0270008 pubmed publisher
Saratov V, Ngo Q, Pedot G, Sidorov S, Wachtel M, Niggli F, et al. CRISPR activation screen identifies TGFβ-associated PEG10 as a crucial tumor suppressor in Ewing sarcoma. Sci Rep. 2022;12:10671 pubmed publisher
Yang H, Ting X, Geng Y, Xie Y, Nierenberg J, Huo Y, et al. The risk variant rs11836367 contributes to breast cancer onset and metastasis by attenuating Wnt signaling via regulating NTN4 expression. Sci Adv. 2022;8:eabn3509 pubmed publisher
Papes F, Camargo A, de Souza J, Carvalho V, Szeto R, LaMontagne E, et al. Transcription Factor 4 loss-of-function is associated with deficits in progenitor proliferation and cortical neuron content. Nat Commun. 2022;13:2387 pubmed publisher
Joung J, Kirchgatterer P, Singh A, Cho J, Nety S, Larson R, et al. CRISPR activation screen identifies BCL-2 proteins and B3GNT2 as drivers of cancer resistance to T cell-mediated cytotoxicity. Nat Commun. 2022;13:1606 pubmed publisher
Sofer S, Lamkiewicz K, Armoza Eilat S, Partouche S, Marz M, Moskovits N, et al. A genome-wide CRISPR activation screen reveals Hexokinase 1 as a critical factor in promoting resistance to multi-kinase inhibitors in hepatocellular carcinoma cells. FASEB J. 2022;36:e22191 pubmed publisher
Hu J, Lai Y, Huang H, Ramakrishnan S, Pan Y, Ma V, et al. TCOF1 upregulation in triple-negative breast cancer promotes stemness and tumour growth and correlates with poor prognosis. Br J Cancer. 2022;126:57-71 pubmed publisher
King R, Lin Z, Balbin Cuesta G, Myers G, Friedman A, Zhu G, et al. SEC23A rescues SEC23B-deficient congenital dyserythropoietic anemia type II. Sci Adv. 2021;7:eabj5293 pubmed publisher
Evron T, Caspi M, Kazelnik M, Shor Nareznoy Y, Armoza Eilat S, Kariv R, et al. A CRISPR knockout screen reveals new regulators of canonical Wnt signaling. Oncogenesis. 2021;10:63 pubmed publisher
Jensen T, Mikkelsen N, Gao Z, Foßelteder J, Pabst G, Axelgaard E, et al. Targeted regulation of transcription in primary cells using CRISPRa and CRISPRi. Genome Res. 2021;31:2120-2130 pubmed publisher
Zhu G, Yu J, Sun Z, Chen Y, Zheng H, Lin M, et al. Genome-wide CRISPR/Cas9 screening identifies CARHSP1 responsible for radiation resistance in glioblastoma. Cell Death Dis. 2021;12:724 pubmed publisher
Dai M, Yan G, Wang N, Daliah G, Edick A, Poulet S, et al. In vivo genome-wide CRISPR screen reveals breast cancer vulnerabilities and synergistic mTOR/Hippo targeted combination therapy. Nat Commun. 2021;12:3055 pubmed publisher
Gu Z, Liu Y, Zhang Y, Cao H, Lyu J, Wang X, et al. Silencing of LINE-1 retrotransposons is a selective dependency of myeloid leukemia. Nat Genet. 2021;53:672-682 pubmed publisher
Khan O, Almagro J, Nelson J, Horswell S, Encheva V, Keyan K, et al. Proteasomal degradation of the tumour suppressor FBW7 requires branched ubiquitylation by TRIP12. Nat Commun. 2021;12:2043 pubmed publisher
Chan W, Gottschalk R, Yao Y, Pomerantz J, Germain R. Efficient Immune Cell Genome Engineering with Enhanced CRISPR Editing Tools. Immunohorizons. 2021;5:117-132 pubmed publisher
Zhang H, Wen J, Bigot A, Chen J, Shang R, Mouly V, et al. Human myotube formation is determined by MyoD-Myomixer/Myomaker axis. Sci Adv. 2020;6: pubmed publisher
Song Q, Ni K, Liu M, Li Y, Wang L, Wang Y, et al. Direct-seq: programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen. Genome Biol. 2020;21:136 pubmed publisher
Hu H, Ji Q, Song M, Ren J, Liu Z, Wang Z, et al. ZKSCAN3 counteracts cellular senescence by stabilizing heterochromatin. Nucleic Acids Res. 2020;48:6001-6018 pubmed publisher
Yamamoto A, Kurata M, Onishi I, Sugita K, Matsumura M, Ishibashi S, et al. CRISPR screening identifies M1AP as a new MYC regulator with a promoter-reporter system. Peerj. 2020;8:e9046 pubmed publisher
Cai J, Chen J, Wu T, Cheng Z, Tian Y, Pu C, et al. Genome-scale CRISPR activation screening identifies a role of LRP8 in Sorafenib resistance in Hepatocellular carcinoma. Biochem Biophys Res Commun. 2020;526:1170-1176 pubmed publisher
Lin C, Mabe N, Lin Y, Yang W, Tang X, Hong L, et al. RIPK3 upregulation confers robust proliferation and collateral cystine-dependence on breast cancer recurrence. Cell Death Differ. 2020;27:2234-2247 pubmed publisher
Zhao W, Yan W, Chen D, Dai L, Yang Y, Kang X, et al. Genome-scale CRISPR activation screening identifies a role of ELAVL2-CDKN1A axis in paclitaxel resistance in esophageal squamous cell carcinoma. Am J Cancer Res. 2019;9:1183-1200 pubmed
Wiel C, Le Gal K, Ibrahim M, Jahangir C, Kashif M, Yao H, et al. BACH1 Stabilization by Antioxidants Stimulates Lung Cancer Metastasis. Cell. 2019;: pubmed publisher
Chee Y, Pahnke J, Bunte R, Adsool V, Madan B, Virshup D. Intrinsic Xenobiotic Resistance of the Intestinal Stem Cell Niche. Dev Cell. 2018;46:681-695.e5 pubmed publisher
Hua J, Ahmed M, Guo H, Zhang Y, Chen S, Soares F, et al. Risk SNP-Mediated Promoter-Enhancer Switching Drives Prostate Cancer through lncRNA PCAT19. Cell. 2018;174:564-575.e18 pubmed publisher
Bester A, Lee J, Chavez A, Lee Y, Nachmani D, Vora S, et al. An Integrated Genome-wide CRISPRa Approach to Functionalize lncRNAs in Drug Resistance. Cell. 2018;173:649-664.e20 pubmed publisher
Alexanian M, Maric D, Jenkinson S, Mina M, Friedman C, Ting C, et al. A transcribed enhancer dictates mesendoderm specification in pluripotency. Nat Commun. 2017;8:1806 pubmed publisher
Joung J, Konermann S, Gootenberg J, Abudayyeh O, Platt R, Brigham M, et al. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc. 2017;12:828-863 pubmed publisher
product information
Catalog Number :
89308
Product Name :
lentiMPH v2
article :
doi10.1038/nprot.2017.016
id25390
pubmed_id28333914
bacterial resistance :
Ampicillin
cloning :
backboneplenti
backbone_mutation
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
growth strain :
lenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker (EF1a-MS2-p65-HSF1-2A-Hygro-WPRE). This version has a higher virus titer.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3BsiWI
cloning_site_5EcoRI
promoterEF1a
sequencing_primer_3GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
sequencing_primer_5cacatagcgtaaaaggagcaacatag
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesAIF3BL3, CMCU, NFKB3, p65
geneRELA
id5970
genbank_ids
mutationN55K in MS2
nameMS2-P65-HSF1_2A_Hygro
shRNA_sequence
size2526
species
9606
Homo sapiens
100
Synthetic
tags
resistance markers :
898
tags :
High Copy
terms :
Hygromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA