This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pGADT7 Hsh155 H331D
catalog :
87295
citations: 1
product information
Catalog Number :
87295
Product Name :
pGADT7 Hsh155 H331D
article :
| doi | 10.1093/nar/gkw1349 |
| id | 23119 |
| pubmed_id | 28062854 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pGADT7 | ||
| backbone_mutation | |||
| backbone_origin | Clontech | ||
| backbone_size | 7987 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth strain :
Encodes Y2H Gal4 activation domain for Hsh155 H331D
origin :
37
pi :
cerevisiaetags
Enzymecloning_site_3<
/td> BamHI cloning_
site_5 XmaI pr
omoter sequen
cing_primer_3 GCTCGAGCTCGATGGAT
CCTCACAGAACTAAATCCAGTTCTTC >sequencing_primer_5 CCAGTG
AATTCCACCCGGGAATGAGTCATCCGATTCAATTTGd> site_3_destroyed > site_5_destroyed >d>entrez_gene
r>genbank_ids
r>mutation H331D
tr>name HSH155 >shRNA_sequence
tr>size 2923 <
tr>species
|
Enzyme
/td>
site_5
omoter
cing_primer_3
CCTCACAGAACTAAATCCAGTTCTTC
AATTCCACCCGGGAATGAGTCATCCGATTCAATTTGd>
| aliases | YMR288Wd> | gene | HSH155 | id | 855332 | |
tr>
tr>
tr>
| < table> | |||||||||
| 4932 | |||||||||
| Sac charomyces
|
