This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pEGFP-C1-AR V7
catalog :
86856
citations: 3
Reference |
---|
product information
Catalog Number :
86856
Product Name :
pEGFP-C1-AR V7
article :
doi | 10.1002/pros.23251 |
id | 23014 |
pubmed_id | 27699828 |
bacterial resistance :
Kanamycin
cloning :
backbone | pEGFP-C1 | |
backbone_mutation | none | |
backbone_origin | Clontech (Takara) | |
backbone_size | 4731 | |
promoter | ||
sequencing_primer_3 | ||
sequencing_primer_5 | ||
vector_types |
|
growth notes :
The poly-glutamine repeat region in this plasmid is known to be unstable and the exact number of repeats may vary. However, repeats of 18-26 glutamines are all considered wildtype. Screen multiple colonies to ensure isolation of a plasmid with a suitable number of repeats. Prostate. 2013 February 15; 73(3): 267 277. doi:10.1002/pros.22566. The activity of the androgen receptor variant AR-V7 is regulated by FOXO1 in a PTEN-PI3K-AKT-dependent way. Cloning is described in the supplemental materials (excerpted below). Cloning Strategy The carboxy-terminal part of AR-V7 and AR-V1 were PCR amplified by using the following primers: sense (common for AR-V1 and AR-V7 amplification) 5 -GCGCAAGCTTCTGGGTGTCACTATGGAGC (harboring a Hind III site), antisense for AR-V7 GCTCTAGATCAGGGTCTGGTCATTTTGAGATGC (harboring a XbaI site), antisense for AR-V1 GCTCTAGATTAAGGAAGCCATTCTGAGACTCC (also harboring a XbaI site). CMV-AR-V7 and CMV-AR-V1 were generated by replacing a HindIII-XbaI cDNA fragment encoding the carboxy-terminal portion of wild-type AR (subcloned into a pcDNA3 plasmid) with the AR-V7 or AR-V1 fragments generated by PCR. GFP-AR-V7 and GFP-AR-V1 were generated by replacing an XmaI-XbaI cDNA fragment encoding the carboxy-terminal part of wild-type AR, subcloned in frame to the green fluorescent protein of plasmid pEGFP-c1, with XmaI-XbaI fragments from the pcDNA3 plasmids containing the AR-V7 and AR-V1 variants.
growth strain :
Fluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)
growth temp :
Sequence-verify the poly-glutamine expansion when preparing new plasmid preps. Depositor recommends screening a handful of colonies. See Depositor Comments for more information.
origin :
37
pi :
|
resistance markers :
922 |
3237 |
tags :
High Copy
terms :
Neomycin (select with G418) |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments