This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
EZ-Tet-pLKO-Puro
catalog :
85966
citations: 16
Reference
Juarez D, Buono R, Matulis S, Gupta V, Duong M, Yudiono J, et al. Statin-induced Mitochondrial Priming Sensitizes Multiple Myeloma Cells to BCL2 and MCL-1 Inhibitors. Cancer Res Commun. 2023;3:2497-2509 pubmed publisher
Herron R, Kunisky A, Madden J, Anyaeche V, Maung M, Hwang H. A twin UGUA motif directs the balance between gene isoforms through CFIm and the mTORC1 signaling pathway. elife. 2023;12: pubmed publisher
Prislusky M, Lam J, Contreras V, Ng M, Chamberlain M, Fields M, et al. The Septin Cytoskeleton is Required for Plasma Membrane Repair. bioRxiv. 2023;: pubmed publisher
Gonthier K, Weidmann C, Berthiaume L, Jobin C, Lacouture A, Lafront C, et al. Isocitrate dehydrogenase 1 sustains a hybrid cytoplasmic-mitochondrial tricarboxylic acid cycle that can be targeted for therapeutic purposes in prostate cancer. Mol Oncol. 2023;: pubmed publisher
Panizza E, Regalado B, Wang F, Nakano I, Vacanti N, Cerione R, et al. Proteomic analysis reveals microvesicles containing NAMPT as mediators of radioresistance in glioma. Life Sci Alliance. 2023;6: pubmed publisher
Hu C, Wang A, Fan D, Worth M, Chen Z, Huang J, et al. Cancer-derived mutation in the OGA stalk domain promotes cell malignancy through dysregulating PDLIM7 and p53. Res Sq. 2023;: pubmed publisher
Rajabian N, Ikhapoh I, Shahini S, Choudhury D, Thiyagarajan R, Shahini A, et al. Methionine adenosyltransferase2A inhibition restores metabolism to improve regenerative capacity and strength of aged skeletal muscle. Nat Commun. 2023;14:886 pubmed publisher
Blankenship C, Xie J, Benz C, Wang A, Ivarsson Y, Jiang J. A novel binding site on the cryptic intervening domain is a motif-dependent regulator of O-GlcNAc transferase. Res Sq. 2023;: pubmed publisher
Prifti D, Lauzier A, Elowe S. A commercial ARHGEF17/TEM4 antibody cross-reacts with Nuclear Mitotic Apparatus protein 1 (NuMA). PLoS ONE. 2022;17:e0268848 pubmed publisher
Kamada H, Yasuhira S, Shibazaki M, Amano H, Maesawa C. DUSP4 Inactivation Leads to Reduced Extracellular Signal‒Regulated Kinase Activity through Upregulation of DUSP6 in Melanoma Cells. J Invest Dermatol. 2022;: pubmed publisher
La T, Chen S, Guo T, Zhao X, Teng L, Li D, et al. Visualization of endogenous p27 and Ki67 reveals the importance of a c-Myc-driven metabolic switch in promoting survival of quiescent cancer cells. Theranostics. 2021;11:9605-9622 pubmed publisher
Norton J, Augert A, Eastwood E, Basom R, Rudin C, MacPherson D. Protein neddylation as a therapeutic target in pulmonary and extrapulmonary small cell carcinomas. Genes Dev. 2021;35:870-887 pubmed publisher
Ghosh M, Saha S, Bettke J, Nagar R, Parrales A, Iwakuma T, et al. Mutant p53 suppresses innate immune signaling to promote tumorigenesis. Cancer Cell. 2021;: pubmed publisher
Nollet E, Cardo Vila M, Ganguly S, Tran J, Schulz V, Cress A, et al. Androgen receptor-induced integrin α6β1 and Bnip3 promote survival and resistance to PI3K inhibitors in castration-resistant prostate cancer. Oncogene. 2020;: pubmed publisher
Mourikis T, Benedetti L, Foxall E, Temelkovski D, Nulsen J, Perner J, et al. Patient-specific cancer genes contribute to recurrently perturbed pathways and establish therapeutic vulnerabilities in esophageal adenocarcinoma. Nat Commun. 2019;10:3101 pubmed publisher
Frank S, Schulz V, Miranti C. A streamlined method for the design and cloning of shRNAs into an optimized Dox-inducible lentiviral vector. BMC Biotechnol. 2017;17:24 pubmed publisher
product information
Catalog Number :
85966
Product Name :
EZ-Tet-pLKO-Puro
article :
doi10.1186/s12896-017-0341-x [pii]
id25241
pubmed_id28245848
bacterial resistance :
Ampicillin
cloning :
backboneTet-pLKO-Puro
backbone_mutationShrunk stuffer and changed 5' cloning site from AgeI to NheI.
backbone_originDmitri Wiederschain
backbone_size10633
promoterH1 / TetO
sequencing_primer_3AACCCAGGGCTGCCTTGG
sequencing_primer_5ATTAGTGAACGGATCTCGACGG
vector_types
Lentiviral
RNAi
growth notes :
Modified from Wiederschain et al., Addgene plasmid #21915
growth strain :
Tet/Dox inducible shRNA lentivirus with puromycin selection
origin :
37
resistance markers :
3201
tags :
Low Copy
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA