This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pMRX-IP-GFP-LC3-RFP
catalog :
84573
citations: 30
Reference
Huang Z, Kaller M, Hermeking H. CRISPR/Cas9-mediated inactivation of miR-34a and miR-34b/c in HCT116 colorectal cancer cells: comprehensive characterization after exposure to 5-FU reveals EMT and autophagy as key processes regulated by miR-34. Cell Death Differ. 2023;: pubmed publisher
Brobbey C, Yin S, Liu L, Ball L, Howe P, Delaney J, et al. Autophagy dictates sensitivity to PRMT5 inhibitor in breast cancer. Sci Rep. 2023;13:10752 pubmed publisher
Du Y, Chang W, Gao L, Deng L, Ji W. Tex2 is required for lysosomal functions at TMEM55-dependent ER membrane contact sites. J Cell Biol. 2023;222: pubmed publisher
Wang Y, Wang M, Liu Y, Tao H, Banerjee S, Srinivasan S, et al. Integrated regulation of stress responses, autophagy and survival by altered intracellular iron stores. Redox Biol. 2022;55:102407 pubmed publisher
Jassey A, Wagner M, Galitska G, Paudel B, Miller K, Jackson W. Starvation after infection restricts enterovirus D68 replication. Autophagy. 2022;:1-14 pubmed publisher
Yu P, Fu P, Zeng L, Qi Y, Li X, Wang Q, et al. EGCG Restricts PRRSV Proliferation by Disturbing Lipid Metabolism. Microbiol Spectr. 2022;10:e0227621 pubmed publisher
Wang F, Yang Y, Boudagh G, Eskelinen E, Klionsky D, Malek S. Follicular lymphoma-associated mutations in the V-ATPase chaperone VMA21 activate autophagy creating a targetable dependency. Autophagy. 2022;:1-19 pubmed publisher
Zhu L, Retana D, García Gómez P, Álvaro Espinosa L, Priego N, Masmudi Martín M, et al. A clinically compatible drug-screening platform based on organotypic cultures identifies vulnerabilities to prevent and treat brain metastasis. EMBO Mol Med. 2022;14:e14552 pubmed publisher
Xing Y, Wei X, Wang M, Liu Y, Sui Z, Wang X, et al. Stimulating TRPM7 suppresses cancer cell proliferation and metastasis by inhibiting autophagy. Cancer Lett. 2022;525:179-197 pubmed publisher
Xing Y, Wei X, Liu Y, Wang M, Sui Z, Wang X, et al. Autophagy inhibition mediated by MCOLN1/TRPML1 suppresses cancer metastasis via regulating a ROS-driven TP53/p53 pathway. Autophagy. 2021;:1-23 pubmed publisher
Zehender A, Li Y, Lin N, Stefanica A, Nüchel J, Chen C, et al. TGFβ promotes fibrosis by MYST1-dependent epigenetic regulation of autophagy. Nat Commun. 2021;12:4404 pubmed publisher
Diehl V, Wegner M, Grumati P, Husnjak K, Schaubeck S, Gubas A, et al. Minimized combinatorial CRISPR screens identify genetic interactions in autophagy. Nucleic Acids Res. 2021;49:5684-5704 pubmed publisher
Qi J, Xing Y, Liu Y, Wang M, Wei X, Sui Z, et al. MCOLN1/TRPML1 finely controls oncogenic autophagy in cancer by mediating zinc influx. Autophagy. 2021;:1-22 pubmed publisher
Yuizumi N, Harada Y, Kuniya T, Sunabori T, Koike M, Wakabayashi M, et al. Maintenance of neural stem-progenitor cells by the lysosomal biosynthesis regulators TFEB and TFE3 in the embryonic mouse telencephalon. Stem Cells. 2021;39:929-944 pubmed publisher
Trelford C, Di Guglielmo G. Assessing methods to quantitatively validate TGFβ-dependent autophagy. Biol Open. 2020;9: pubmed publisher
Wang C, Chen C, Lin M, Su H, Ho M, Yeh J, et al. TLR9 Binding to Beclin 1 and Mitochondrial SIRT3 by a Sodium-Glucose Co-Transporter 2 Inhibitor Protects the Heart from Doxorubicin Toxicity. Biology (Basel). 2020;9: pubmed publisher
Lennikov A, Mukwaya A, Saddala M, Huang H. Deficiency of C-X-C chemokine receptor type 5 (CXCR5) gene causes dysfunction of retinal pigment epithelium cells. Lab Invest. 2021;101:228-244 pubmed publisher
Li Z, Tian X, Ji X, Wang J, Chen H, Wang D, et al. ULK1-ATG13 and their mitotic phospho-regulation by CDK1 connect autophagy to cell cycle. PLoS Biol. 2020;18:e3000288 pubmed publisher
Mao K, Chen J, Yu H, Li H, Ren Y, Wu X, et al. Poly (ADP-ribose) polymerase 1 inhibition prevents neurodegeneration and promotes α-synuclein degradation via transcription factor EB-dependent autophagy in mutant α-synucleinA53T model of Parkinson's disease. Aging Cell. 2020;19:e13163 pubmed publisher
Kilpeläinen T, Hellinen L, Vrijdag J, Yan X, Svarcbahs R, Vellonen K, et al. The effect of prolyl oligopeptidase inhibitors on alpha-synuclein aggregation and autophagy cannot be predicted by their inhibitory efficacy. Biomed Pharmacother. 2020;128:110253 pubmed publisher
Svarcbahs R, Jäntti M, Kilpeläinen T, Julku U, Urvas L, Kivioja S, et al. Prolyl oligopeptidase inhibition activates autophagy via protein phosphatase 2A. Pharmacol Res. 2020;151:104558 pubmed publisher
Lear T, Lockwood K, Ouyang Y, EVANKOVICH J, Larsen M, Lin B, et al. The RING-type E3 ligase RNF186 ubiquitinates Sestrin-2 and thereby controls nutrient sensing. J Biol Chem. 2019;294:16527-16534 pubmed publisher
Tan W, Xu T, Zhou Z, Lv X, Liu J, Zhang W, et al. TRP14 promotes resistance to cisplatin by inducing autophagy in ovarian cancer. Oncol Rep. 2019;: pubmed publisher
Zhao M, Chen J, Mao K, She H, Ren Y, Gui C, et al. Mitochondrial calcium dysfunction contributes to autophagic cell death induced by MPP+ via AMPK pathway. Biochem Biophys Res Commun. 2019;509:390-394 pubmed publisher
King B, Kulak K, Krus U, Rosberg R, Golec E, Wozniak K, et al. Complement Component C3 Is Highly Expressed in Human Pancreatic Islets and Prevents β Cell Death via ATG16L1 Interaction and Autophagy Regulation. Cell Metab. 2019;29:202-210.e6 pubmed publisher
Park S, Baek K, Shin I, Shin I. Subcellular Hsp70 Inhibitors Promote Cancer Cell Death via Different Mechanisms. Cell Chem Biol. 2018;25:1242-1254.e8 pubmed publisher
Li X, Fu Q, Zhou M, Hu K, Du X, Li X, et al. Isoscoparins R and S, two new ent-clerodane diterpenoids from Isodon scoparius. J Asian Nat Prod Res. 2018;:1-8 pubmed publisher
Morita M, Sato T, Nomura M, Sakamoto Y, Inoue Y, Tanaka R, et al. PKM1 Confers Metabolic Advantages and Promotes Cell-Autonomous Tumor Cell Growth. Cancer Cell. 2018;33:355-367.e7 pubmed publisher
Li Y, Zhang Y, Wang L, Wang P, Xue Y, Li X, et al. Autophagy impairment mediated by S-nitrosation of ATG4B leads to neurotoxicity in response to hyperglycemia. Autophagy. 2017;13:1145-1160 pubmed publisher
Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, et al. An Autophagic Flux Probe that Releases an Internal Control. Mol Cell. 2016;64:835-849 pubmed publisher
product information
Catalog Number :
84573
Product Name :
pMRX-IP-GFP-LC3-RFP
article :
doi10.1016/j.molcel.2016.09.037
id28190061
pubmed_id27818143
bacterial resistance :
Ampicillin
cloning :
backbonepMRX-IP
backbone_mutation
backbone_originDr.Shoji Yamaoka of Tokyo Medical and Dental University
backbone_size6100
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Retroviral
growth strain :
Expresses GFP-LC3-RFP in mammalian cells to measure autophagic flux
origin :
37
pi :
alt_names
Map1lc3b
LC3
LC3B
cloning
clone_methodRestriction Enzyme
cloning_site_3Bgl II
cloning_site_5Bgl II
promoter
sequencing_primer_3AAAAGACGGCAATATGGTGG
sequencing_primer_5CGACCACTACCAGCAGAACA
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesLC3B, Map1lc3, Mpl3, zbs559
geneMap1lc3b
id64862
genbank_ids
U05784
NM_022867.2
mutation
namemicrotubule-associated protein 1 light chain 3 beta
shRNA_sequence
size1800
species
10116
Rattus norvegicus
32644
Other
tags
locationN terminal on insert
tagEGFP
locationC terminal on insert
tagmRFP1
plasmid copy :
It has the pMX backbone
resistance markers :
644
tags :
Unknown
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA