This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pMRX-IP-GFP-LC3-RFP-LC3 G
catalog :
84572
citations: 40
Reference
Mariner B, Rodriguez A, Heath O, McCormick M. Induction of proteasomal activity in mammalian cells by lifespan-extending tRNA synthetase inhibitors. GeroScience. 2023;: pubmed publisher
Liao E, Yang M, Nathan Kochen N, Vunnam N, Braun A, Ferguson D, et al. Proteasomal Stimulation by MK886 and Its Derivatives Can Rescue Tau-Induced Neurite Pathology. Mol Neurobiol. 2023;60:6133-6144 pubmed publisher
Gupta U, Ghosh S, Wallace C, Shang P, Xin Y, Nair A, et al. Increased LCN2 (lipocalin 2) in the RPE decreases autophagy and activates inflammasome-ferroptosis processes in a mouse model of dry AMD. Autophagy. 2023;19:92-111 pubmed publisher
Mohanasundaram P, Coelho Rato L, Modi M, Urbanska M, Lautenschl xe4 ger F, Cheng F, et al. Cytoskeletal vimentin regulates cell size and autophagy through mTORC1 signaling. PLoS Biol. 2022;20:e3001737 pubmed publisher
Liu J, Liu Y, Wang Y, Li C, Xie Y, Klionsky D, et al. TMEM164 is a new determinant of autophagy-dependent ferroptosis. Autophagy. 2022;:1-12 pubmed publisher
Liu K, Huang J, Liu J, Klionsky D, Kang R, Tang D. Induction of autophagy-dependent ferroptosis to eliminate drug-tolerant human retinoblastoma cells. Cell Death Dis. 2022;13:521 pubmed publisher
Frey N, Tortola L, Egli D, Janjuha S, Rothgangl T, Marquart K, et al. Loss of Rnf31 and Vps4b sensitizes pancreatic cancer to T cell-mediated killing. Nat Commun. 2022;13:1804 pubmed publisher
Huang B, Phelan J, Preite S, Gomez Rodriguez J, Johansen K, Shibata H, et al. In vivo CRISPR screens reveal a HIF-1α-mTOR-network regulates T follicular helper versus Th1 cells. Nat Commun. 2022;13:805 pubmed publisher
Remy J, Linder B, Weirauch U, Day B, Stringer B, Herold Mende C, et al. STAT3 Enhances Sensitivity of Glioblastoma to Drug-Induced Autophagy-Dependent Cell Death. Cancers (Basel). 2022;14: pubmed publisher
Qiao Y, Choi J, Tien J, Simko S, RAJENDIRAN T, Vo J, et al. Autophagy Inhibition by Targeting PIKfyve Potentiates Response to Immune Checkpoint Blockade in Prostate Cancer. Nat Cancer. 2021;2:978-993 pubmed publisher
Shyam R, Ogando D, Choi M, Liton P, Bonanno J. Mitochondrial ROS Induced Lysosomal Dysfunction and Autophagy Impairment in an Animal Model of Congenital Hereditary Endothelial Dystrophy. Invest Ophthalmol Vis Sci. 2021;62:15 pubmed publisher
Yan F, Zhang X, Tan R, Li M, Xiao Z, Wang H, et al. Autophagic flux in cancer cells at the invasive front in the tumor-stroma border. Aging (Albany NY). 2021;13:20229-20245 pubmed publisher
Cabezudo S, Sanz Flores M, Caballero A, Tasset I, Rebollo E, Díaz A, et al. Gαq activation modulates autophagy by promoting mTORC1 signaling. Nat Commun. 2021;12:4540 pubmed publisher
Liu Q, Wu J, Zhang X, Li X, Wu X, Zhao Y, et al. Circulating mitochondrial DNA-triggered autophagy dysfunction via STING underlies sepsis-related acute lung injury. Cell Death Dis. 2021;12:673 pubmed publisher
Deitersen J, Berning L, Stuhldreier F, Ceccacci S, Schlütermann D, Friedrich A, et al. High-throughput screening for natural compound-based autophagy modulators reveals novel chemotherapeutic mode of action for arzanol. Cell Death Dis. 2021;12:560 pubmed publisher
Huynh D, Jin Y, Myung C, Heo K. Ginsenoside Rh1 Induces MCF-7 Cell Apoptosis and Autophagic Cell Death through ROS-Mediated Akt Signaling. Cancers (Basel). 2021;13: pubmed publisher
Chang H, Tao R, Tan C, Wu Y, Bay B, Yu V. The BAX-binding protein MOAP1 associates with LC3 and promotes closure of the phagophore. Autophagy. 2021;:1-15 pubmed publisher
Nichenko A, Sorensen J, Southern W, Qualls A, Schifino A, McFaline Figueroa J, et al. Lifelong Ulk1-Mediated Autophagy Deficiency in Muscle Induces Mitochondrial Dysfunction and Contractile Weakness. Int J Mol Sci. 2021;22: pubmed publisher
Kuang F, Liu J, Li C, Kang R, Tang D. Cathepsin B is a mediator of organelle-specific initiation of ferroptosis. Biochem Biophys Res Commun. 2020;533:1464-1469 pubmed publisher
Dolai S, Takahashi T, Qin T, Liang T, Xie L, Kang F, et al. Pancreas-specific SNAP23 depletion prevents pancreatitis by attenuating pathological basolateral exocytosis and formation of trypsin-activating autolysosomes. Autophagy. 2021;17:3068-3081 pubmed publisher
Wang C, Chen C, Lin M, Su H, Ho M, Yeh J, et al. TLR9 Binding to Beclin 1 and Mitochondrial SIRT3 by a Sodium-Glucose Co-Transporter 2 Inhibitor Protects the Heart from Doxorubicin Toxicity. Biology (Basel). 2020;9: pubmed publisher
Zhang R, Pan T, Xiang Y, Zhang M, Feng J, Liu S, et al. β-Elemene Reverses the Resistance of p53-Deficient Colorectal Cancer Cells to 5-Fluorouracil by Inducing Pro-death Autophagy and Cyclin D3-Dependent Cycle Arrest. Front Bioeng Biotechnol. 2020;8:378 pubmed publisher
Wang C, Lin T, Ho M, Yeh J, Tsai M, Hung K, et al. Regulation of autophagy in leukocytes through RNA N6-adenosine methylation in chronic kidney disease patients. Biochem Biophys Res Commun. 2020;527:953-959 pubmed publisher
Liao W, Zhang Y. MicroRNA-381 facilitates autophagy and apoptosis in prostate cancer cells via inhibiting the RELN-mediated PI3K/AKT/mTOR signaling pathway. Life Sci. 2020;254:117672 pubmed publisher
Chen X, Kwan J, Chang R, Ma A. 1-phenyl 2-thiourea (PTU) activates autophagy in zebrafish embryos. Autophagy. 2020;:1-10 pubmed publisher
Call J, Nichenko A. Autophagy: an essential but limited cellular process for timely skeletal muscle recovery from injury. Autophagy. 2020;16:1344-1347 pubmed publisher
Chen Y, Wang H, Ying Z, Gao Q. Ibudilast enhances the clearance of SOD1 and TDP-43 aggregates through TFEB-mediated autophagy and lysosomal biogenesis: The new molecular mechanism of ibudilast and its implication for neuroprotective therapy. Biochem Biophys Res Commun. 2020;526:231-238 pubmed publisher
Zhao C, Qiu S, He J, Peng Y, Xu H, Feng Z, et al. Prodigiosin impairs autophagosome-lysosome fusion that sensitizes colorectal cancer cells to 5-fluorouracil-induced cell death. Cancer Lett. 2020;481:15-23 pubmed publisher
Hasanain M, Sahai R, Pandey P, Maheshwari M, Choyal K, Gandhi D, et al. Microtubule disrupting agent-mediated inhibition of cancer cell growth is associated with blockade of autophagic flux and simultaneous induction of apoptosis. Cell Prolif. 2020;53:e12749 pubmed publisher
Wang M, Wang H, Tao Z, Xia Q, Hao Z, Prehn J, et al. C9orf72 associates with inactive Rag GTPases and regulates mTORC1-mediated autophagosomal and lysosomal biogenesis. Aging Cell. 2020;19:e13126 pubmed publisher
Cui W, Sathyanarayan A, Lopresti M, Aghajan M, Chen C, Mashek D. Lipophagy-derived fatty acids undergo extracellular efflux via lysosomal exocytosis. Autophagy. 2020;:1-16 pubmed publisher
Nichenko A, Southern W, Tehrani K, Qualls A, Flemington A, Mercer G, et al. Mitochondrial-specific autophagy linked to mitochondrial dysfunction following traumatic freeze injury in mice. Am J Physiol Cell Physiol. 2020;318:C242-C252 pubmed publisher
Lim C, Davis O, Shin H, Zhang J, Berdan C, Jiang X, et al. ER-lysosome contacts enable cholesterol sensing by mTORC1 and drive aberrant growth signalling in Niemann-Pick type C. Nat Cell Biol. 2019;21:1206-1218 pubmed publisher
Martin A, Jacquemyn M, Lipecka J, Chhuon C, Aushev V, Meunier B, et al. STK38 kinase acts as XPO1 gatekeeper regulating the nuclear export of autophagy proteins and other cargoes. EMBO Rep. 2019;20:e48150 pubmed publisher
Yazawa R, Nishida Y, Aoyama S, Tanida I, Miyatsuka T, Suzuki L, et al. Establishment of a system for screening autophagic flux regulators using a modified fluorescent reporter and CRISPR/Cas9. Biochem Biophys Res Commun. 2019;: pubmed publisher
Ding X, Jiang X, Tian R, Zhao P, Li L, Wang X, et al. RAB2 regulates the formation of autophagosome and autolysosome in mammalian cells. Autophagy. 2019;:1-13 pubmed publisher
Zielke S, Meyer N, Mari M, Abou El Ardat K, Reggiori F, van Wijk S, et al. Loperamide, pimozide, and STF-62247 trigger autophagy-dependent cell death in glioblastoma cells. Cell Death Dis. 2018;9:994 pubmed publisher
Min Z, Ting Y, Mingtao G, Xiaofei T, Dong Y, Chenguang Z, et al. Monitoring autophagic flux using p62/SQSTM1 based luciferase reporters in glioma cells. Exp Cell Res. 2018;363:84-94 pubmed publisher
Nguyen T, Louie S, Daniele J, Tran Q, Dillin A, Zoncu R, et al. DGAT1-Dependent Lipid Droplet Biogenesis Protects Mitochondrial Function during Starvation-Induced Autophagy. Dev Cell. 2017;42:9-21.e5 pubmed publisher
Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, et al. An Autophagic Flux Probe that Releases an Internal Control. Mol Cell. 2016;64:835-849 pubmed publisher
product information
Catalog Number :
84572
Product Name :
pMRX-IP-GFP-LC3-RFP-LC3 G
article :
doi10.1016/j.molcel.2016.09.037
id28190061
pubmed_id27818143
bacterial resistance :
Ampicillin
cloning :
backbonepMRX-IP
backbone_mutation
backbone_originDr.Shoji Yamaoka of Tokyo Medical and Dental University
backbone_size6100
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Retroviral
growth strain :
Expresses GFP-LC3-RFP-LC3 G in mammalian cells to measure autophagic flux
origin :
37
pi :
alt_names
Map1lc3b
LC3
LC3B
cloning
clone_methodRestriction Enzyme
cloning_site_3Bam HI
cloning_site_5Bgl II
promoter
sequencing_primer_3AAAAGACGGCAATATGGTGG
sequencing_primer_5CGACCACTACCAGCAGAACA
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesLC3B, Map1lc3, Mpl3, zbs559
geneMap1lc3b
id64862
genbank_ids
NM_022867.2
mutation
namemicrotubule-associated protein 1 light chain 3 beta
shRNA_sequence
size2200
species
10116
Rattus norvegicus
tags
locationN terminal on insert
tagEGFP
locationC terminal on insert
tagmRFP1
plasmid copy :
It has the pMX backbone
resistance markers :
644
tags :
Unknown
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA