This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pUB6_EZH2
catalog :
84014
citations: 1
Reference
Kim E, Ilagan J, Liang Y, Daubner G, Lee S, Ramakrishnan A, et al. SRSF2 Mutations Contribute to Myelodysplasia by Mutant-Specific Effects on Exon Recognition. Cancer Cell. 2015;27:617-30 pubmed publisher
product information
Catalog Number :
84014
Product Name :
pUB6_EZH2
article :
doi10.1016/j.ccell.2015.04.006
id22373
pubmed_id25965569
bacterial resistance :
Ampicillin
cloning :
backbonepUB6/V5-HisA
backbone_mutation
backbone_originInvitrogen
backbone_size9268
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth strain :
EZH2 minigene to test splicing event
origin :
37
pi :
alt_names
cloning
clone_methodGateway Cloning
cloning_site_3
cloning_site_5
promoterUB6
sequencing_primer_3TCGAAGGGCCCTCTAGACTC
sequencing_primer_5TCAGTGTTAGACTAGTAAAT
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2
geneEZH2
id2146
genbank_ids
mutation
nameEZH2
shRNA_sequence
size1811
species
9606
Homo sapiens
tags
resistance markers :
3071
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA