This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pTRIPZ (M)-YFP-Ezh2
catalog :
82511
citations: 1
Reference
Rastgoo N, Pourabdollah M, Abdi J, Reece D, Chang H. Dysregulation of EZH2/miR-138 axis contributes to drug resistance in multiple myeloma by downregulating RBPMS. Leukemia. 2018;32:2471-2482 pubmed publisher
product information
Catalog Number :
82511
Product Name :
pTRIPZ (M)-YFP-Ezh2
URL :
www.addgene.org/82511/
article :
doi
id22070
pubmed_id
bacterial resistance :
Ampicillin
cloning :
backbonepTRIPZ (M)
backbone_mutation
backbone_origin
backbone_size12960
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
description :
Lentivirus vector. Expresses YFP-Ezh2 fusion proteins in mammalian cells.
growth temp :
37
inserts :
alt_names
Ezh2
cloning
clone_methodRestriction Enzyme
cloning_site_3Mlu1
cloning_site_5Xho1
promotercmv
sequencing_primer_3cctcacggcgagcgctgccacgtca
sequencing_primer_5cgtgaccgccgccgggatcactctc
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
XM_005249962
mutation
nameEnhancer Of Zeste 2 Polycomb Repressive Complex 2
shRNA_sequence
size2241
species
9606
Homo sapiens
tags
locationN terminal on insert
tagYFP
pi :
3039
plasmid copy :
High Copy
resistance markers :
Neomycin (select with G418)
terms :
MTA, Ancillary Agreement for Plasmids Containing FP Materials (current version), Institut Pasteur Label License for cPPT (current version)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA