This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
acta 2
catalog :
78711
citations: 1
| Reference |
|---|
Georgijevic S, Subramanian Y, Rollins E, Starovic Subota O, Tang A, Childs S. Spatiotemporal expression of smooth muscle markers in developing zebrafish gut. Dev Dyn. 2007;236:1623-32 pubmed
|
product information
Catalog Number :
78711
Product Name :
acta 2
article :
| doi | 10.1002/dvdy.21165 |
| id | 18452 |
| pubmed_id | 17474123 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pBluescript | |
| backbone_mutation | ||
| backbone_origin | ||
| backbone_size | ||
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth notes :
Primers used to amplify cDNA: CCCAGCACTGTCAGGTGATT and CCCATTCCTACCATCACTCC acta2 promoter = A 300 bp proximal promoter for acta2 and 2165 bp fragment from the acta2 intron 1. The two genomic fragments were fused in a PCR reaction to make a 2465 bp enhancer/promoter construct Acta2 3'UTR is in reverse orientation with t1440del, t1454c and a1578g compared to reference sequence. Depositor states that these discrepancies do not affect plasmid function.
growth strain :
zebrafish acta2 3-UTR specific probe
origin :
37
pi :
|
resistance markers :
| 2863 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments