This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pMAL-c2X
catalog :
75286
citations: 15
Reference
Keeler A, Petruzziello P, Boger E, D Ambrosio H, Derbyshire E. Exploring the Chain Release Mechanism from an Atypical Apicomplexan Polyketide Synthase. Biochemistry. 2023;62:2677-2688 pubmed publisher
Charman M, Grams N, Kumar N, Halko E, Dybas J, Abbott A, et al. A viral biomolecular condensate coordinates assembly of progeny particles. Nature. 2023;616:332-338 pubmed publisher
Tun W, Yoon J, Vo K, Cho L, Hoang T, Peng X, et al. Sucrose preferentially promotes expression of OsWRKY7 and OsPR10a to enhance defense response to blast fungus in rice. Front Plant Sci. 2023;14:1117023 pubmed publisher
Koca Y, Vuong L, Singh J, Giniger E, Mlodzik M. Notch-dependent Abl signaling regulates cell motility during ommatidial rotation in Drosophila. Cell Rep. 2022;41:111788 pubmed publisher
Deng Q, Wang C, Koe C, Heinen J, Tan Y, Li S, et al. Parafibromin governs cell polarity and centrosome assembly in Drosophila neural stem cells. PLoS Biol. 2022;20:e3001834 pubmed publisher
Shen H, Yanas A, Owens M, Zhang C, Fritsch C, Fare C, et al. Sexually dimorphic RNA helicases DDX3X and DDX3Y differentially regulate RNA metabolism through phase separation. Mol Cell. 2022;: pubmed publisher
Wang Y, Liu B, Lu H, Liu J, Romanienko P, Montelione G, et al. SETD4-mediated KU70 methylation suppresses apoptosis. Cell Rep. 2022;39:110794 pubmed publisher
Mirzaeinia S, Zeinali S, Budisa N, Karbalaei Heidari H. Targeted Codelivery of Prodigiosin and Simvastatin Using Smart BioMOF: Functionalization by Recombinant Anti-VEGFR1 scFv. Front Bioeng Biotechnol. 2022;10:866275 pubmed publisher
Zhao Q, Li C, Yu M, Sun Y, Wang J, Ma L, et al. HuR stabilizes HTT mRNA via interacting with its exon 11 in a mutant HTT-dependent manner. RNA Biol. 2020;17:500-516 pubmed publisher
Sundaravinayagam D, Rahjouei A, Andreani M, Tupiņa D, Balasubramanian S, Saha T, et al. 53BP1 Supports Immunoglobulin Class Switch Recombination Independently of Its DNA Double-Strand Break End Protection Function. Cell Rep. 2019;28:1389-1399.e6 pubmed publisher
Gambarotto D, Pennetier C, Ryniawec J, Buster D, Gogendeau D, Goupil A, et al. Plk4 Regulates Centriole Asymmetry and Spindle Orientation in Neural Stem Cells. Dev Cell. 2019;: pubmed publisher
Shanmugam S, Backes N, Chen Y, Belardo A, Phillips G, Dalbey R. New Insights into Amino-Terminal Translocation as Revealed by the Use of YidC and Sec Depletion Strains. J Mol Biol. 2019;431:1025-1037 pubmed publisher
Wachtel R, Bräuning B, Mader S, Ecker F, Kaila V, Groll M, et al. The protease GtgE from Salmonella exclusively targets inactive Rab GTPases. Nat Commun. 2018;9:44 pubmed publisher
Zhang G, Lin L, Qi D, Zhang H. The composition of a protein aggregate modulates the specificity and efficiency of its autophagic degradation. Autophagy. 2017;13:1487-1495 pubmed publisher
Walker I, Hsieh P, Riggs P. Mutations in maltose-binding protein that alter affinity and solubility properties. Appl Microbiol Biotechnol. 2010;88:187-97 pubmed publisher
product information
Catalog Number :
75286
Product Name :
pMAL-c2X
article :
doi10.1007/s00253-010-2696-y
id18222
pubmed_id20535468
bacterial resistance :
Ampicillin
cloning :
backbonepMAL-c2X
backbone_mutationnone
backbone_originNew England Biolabs
backbone_size6645
promotertac
sequencing_primer_3CGCCAGGGTTTTCCCAGTCACGAC
sequencing_primer_5GGTCGTCAGACTGTCGATGAAGCC
vector_types
Bacterial Expression
growth strain :
Expresses proteins in the cytoplasm as fusions to maltose-binding protein
growth temp :
Any E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices
origin :
37
resistance markers :
2815
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA