This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCZ886
catalog :
73584
citations: 1
product information
Catalog Number :
73584
Product Name :
pCZ886
article :
| doi | 10.1038/ncomms9868 |
| id | 16562 |
| pubmed_id | 26632265 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pCFJ150 | |||
| backbone_mutation | ||||
| backbone_origin | ||||
| backbone_size | ||||
| promoter | ||||
| sequencing_primer_3 | ||||
| sequencing_primer_5 | ||||
| vector_types |
|
growth strain :
Pmex-5-HIS-72-miniSOG-3'UTR(tbb-2) for optogenetic mutagenesis
origin :
37
pi :
eleganstags
Cloningcloning_site_3
cloning_site
_5 promoter
td> Pmex-5 sequenci
ng_primer_3 GTACCAGAGCTCACCTAGG
caggaacagctatgacccaatgagacttttttcttggcg
gc sequencing_primer_5
GCACCGTACGTCTCGAGtgtaaaacgacgg
ccagtgtacgactcactatagggcgaattg >site_3_destroyed
site_5_destroyed <
/td> entr
ez_gene
r>genbank_ids >mutation >name HIS-72 s
hRNA_sequence >size 467 spec
ies
|
Cloning
_5
td>
ng_primer_3
caggaacagctatgacccaatgagacttttttcttggcg
gc
ccagtgtacgactcactatagggcgaattg
/td>
ez_gene
|
hRNA_sequence
ies
|
