This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
Gg 3kb Green opsin DsRed
catalog :
72918
citations: 1
Reference
Enright J, Lawrence K, Hadzic T, Corbo J. Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. J Comp Neurol. 2015;523:649-68 pubmed publisher
product information
Catalog Number :
72918
Product Name :
Gg 3kb Green opsin DsRed
article :
doi10.1002/cne.23702
id16186
pubmed_id25349106
bacterial resistance :
Ampicillin
cloning :
backbonepCAGGS
backbone_mutationno basal Dsred Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
growth strain :
green opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913 4,501,931 in galGal4 driving DsRed
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3KpnI
cloning_site_5KpnI
promoter
sequencing_primer_3TATTATGGCAGCTGCTTTGC
sequencing_primer_5TGTGACAGGGACACTGAAGG
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namechicken green opsin promoter
shRNA_sequence
size2967
species
9031
Gallus gallus
tags
resistance markers :
2703
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA