This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCS-TRE-FHDnd1-Y102A-Ubc-rtTA-I2G
catalog :
70075
citations: 1
product information
Catalog Number :
70075
Product Name :
pCS-TRE-FHDnd1-Y102A-Ubc-rtTA-I2G
article :
| doi | 10.1038/nature21690 |
| id | 28192353 |
| pubmed_id | 28297718 |
bacterial resistance :
Ampicillin
cloning :
| backbone | CS-TRE-mOKS-PRE-Ubc-rTTA-I2G | ||
| backbone_mutation | |||
| backbone_origin | |||
| backbone_size | 11522 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
RNP1 of RRM domain is mutated (Y102A). Silent mutations are introduced to escape from RNAi using pLKO.1-shDnd1-No. 1,6, and 8 deposited in Addgene (plasmids #70058, 70067, and 70069).
growth strain :
2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 (RRM mutant) in mammalian cells
origin :
37
pi :
musculustags
8name Dnd1d> shRNA_sequence C
CGGGAAGCAGGTACTATGGTTAAGCTCGAGCTTAACCAT
AGTACCTGCTTCTTTTTG siz
e 1203 species
| ||||
|
8
CGGGAAGCAGGTACTATGGTTAAGCTCGAGCTTAACCAT
AGTACCTGCTTCTTTTTG
e
|
