This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pF CAG luc-EGFP-cre puro
catalog :
67503
citations: 2
Reference
Sun C, Li C, Liu W, Schi xf6 th H. Generation of Endogenous Promoter-Driven Luciferase Reporter System Using CRISPR/Cas9 for Investigating Transcriptional Regulation of the Core Clock Gene BMAL1. Biomedicines. 2022;10: pubmed publisher
Stringer B, Day B, D Souza R, Jamieson P, Ensbey K, Bruce Z, et al. A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019;9:4902 pubmed publisher
product information
Catalog Number :
67503
Product Name :
pF CAG luc-EGFP-cre puro
article :
doi10.1038/s41598-019-41277-z
id28192379
pubmed_id30894629
bacterial resistance :
Ampicillin
cloning :
backbonepF MCS puro
backbone_mutation
backbone_origin
backbone_size10733
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
Cre/Lox
Luciferase
Other
Fluorescent protein
growth strain :
Constitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cells
growth temp :
LB broth
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3NheI
cloning_site_5BamHI
promoterCAG
sequencing_primer_3GGGGACTTTCCACACCCTAAC
sequencing_primer_5GCAACGTGCTGGTTGTTGTG
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameluciferase-EGFP-cre
shRNA_sequence
size3459
species
100
Synthetic
32644
Other
Firefly-Aequorea victoria (synthetic)-P1 bacteriophage
tags
plasmid copy :
The firefly luciferase coding sequence was derived from pGL2-Basic. The EGFP-cre sequence was derived from pIGCN21 (NCI at Frederick).
resistance markers :
2451
tags :
High Copy
terms :
Puromycin
Other
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA