This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pC165
catalog :
65949
citations: 1
Reference
Chen Y, Kim J, Hirning A, Josić K, Bennett M. SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Science. 2015;349:986-9 pubmed publisher
product information
Catalog Number :
65949
Product Name :
pC165
article :
doi10.1126/science.aaa3794
id15792
pubmed_id26315440
bacterial resistance :
Kanamycin
cloning :
backbonePMB1+ROP
backbone_mutation
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
growth strain :
P1 activator plasmid for two-strain system
growth temp :
LacIq is necessary
origin :
37
pi :
terminal on inserttagLAA tagged
<
tr>r>d>name<
td>

r>
alt_names
cloning>Unknown<
/tr>>gagaaaactagtatgatcgaattgctctctgaatcgct
g
clone_method
cloning_site_
3
cloning_sit
e_5
promoter<
/td>
pLLac*
sequenc
ing_primer_3
taggggaagcttttatta
cgctgcaagggcgtaattttcgtcgttcgctgc
sequencing_primer_5
site_3_destroyed>
site_5_destroyed
entrez_gened>
r>
aliasesPA3476
generhlI>
id878967
genbank_ids
mutation
RhlI
sh
RNA_sequence

size
645
speci
es
tags
locati
on
C
resistance markers :
1988
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA