This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pINTO-NFH::hSNRNP70
catalog :
65926
citations: 1
product information
Catalog Number :
65926
Product Name :
pINTO-NFH::hSNRNP70
article :
| doi | 10.1021/pr500196b |
| id | 9469 |
| pubmed_id | 25311790 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pINTO-NFH | |
| backbone_mutation | ||
| backbone_origin | custom | |
| backbone_size | 6743 | |
| promoter | CMV/TetO2 (T-REx) | |
| sequencing_primer_3 | AGATGGCTGGCAACTAGAAG | |
| sequencing_primer_5 | CTC GTT TAG TGA ACC GTC AG | |
| vector_types |
|
growth strain :
Expression of human SNRNP70 fused to Flag-HA tag (N-terminus)
origin :
37
pi :
|
resistance markers :
| 2194 |
tags :
High Copy
terms :
| Zeocin |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
