This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
CD63-pEGFP C2
catalog :
62964
citations: 43
Reference
Oxman E, Li H, Wang H, Zohn I. Identification and Functional Analysis of Rare HECTD1 Missense Variants in Human Neural Tube Defects. Res Sq. 2024;: pubmed publisher
Nebogatova J, H xe4 rk H, Puskar A, Porosk L, Guazzi P, Dowaidar M, et al. A Method for Using Cell-Penetrating Peptides for Loading Plasmid DNA into Secreted Extracellular Vesicles. Biomolecules. 2023;13: pubmed publisher
Chang Y, Liu H, Chuang H, Liao J, Kao P, Chan H, et al. Feline mammary carcinoma-derived extracellular vesicle promotes liver metastasis via sphingosine kinase-1-mediated premetastatic niche formation. Lab Anim Res. 2023;39:27 pubmed publisher
Takeda N, Tsuchiya A, Mito M, Natsui K, Natusi Y, Koseki Y, et al. Analysis of distribution, collection, and confirmation of capacity dependency of small extracellular vesicles toward a therapy for liver cirrhosis. Inflamm Regen. 2023;43:48 pubmed publisher
Jang J, Yeo S, Baek S, Jung H, Lee M, Choi S, et al. Abnormal accumulation of extracellular vesicles in hippocampal dystrophic axons and regulation by the primary cilia in Alzheimer's disease. Acta Neuropathol Commun. 2023;11:142 pubmed publisher
Kwak T, Son T, Hong J, Winter U, Jeong M, McLean C, et al. Electrokinetically enhanced label-free plasmonic sensing for rapid detection of tumor-derived extracellular vesicles. Biosens Bioelectron. 2023;237:115422 pubmed publisher
Hur J, Kim Y, Choi D, Kang D, Kim J, Yoo H, et al. Role of Gasdermin E in the Biogenesis of Apoptotic Cell-Derived Exosomes. J Immunol. 2023;: pubmed publisher
Puthukodan S, Hofmann M, Mairhofer M, Janout H, Schurr J, Hauser F, et al. Purification Analysis, Intracellular Tracking, and Colocalization of Extracellular Vesicles Using Atomic Force and 3D Single-Molecule Localization Microscopy. Anal Chem. 2023;95:6061-6070 pubmed publisher
Ko S, Lee W, Weigert M, Jonasch E, Lengyel E, Naora H. The glycoprotein CD147 defines miRNA-enriched extracellular vesicles that derive from cancer cells. J Extracell Vesicles. 2023;12:e12318 pubmed publisher
Bonavita R, Scerra G, Di Martino R, Nuzzo S, Polishchuk E, Di Gennaro M, et al. The HSPB1-p62/SQSTM1 functional complex regulates the unconventional secretion and transcellular spreading of the HD-associated mutant huntingtin protein. Hum Mol Genet. 2023;32:2269-2291 pubmed publisher
Beyers W, Detry A, Di Pietro S. OCA7 is a melanosome membrane protein that defines pigmentation by regulating early stages of melanosome biogenesis. J Biol Chem. 2022;298:102669 pubmed publisher
Begarani F, D Autilia F, Ferri G, Pesce L, Azzarello F, De Lorenzi V, et al. Measuring Molecular Diffusion in Dynamic Subcellular Nanostructures by Fast Raster Image Correlation Spectroscopy and 3D Orbital Tracking. Int J Mol Sci. 2022;23: pubmed publisher
Kim Y, van der Pol E, Arafa A, Thapa I, J Britton C, Kosti J, et al. Calibration and standardization of extracellular vesicle measurements by flow cytometry for translational prostate cancer research. Nanoscale. 2022;: pubmed publisher
Tejeda Muñoz N, Morselli M, Moriyama Y, Sheladiya P, Pellegrini M, De Robertis E. Canonical Wnt signaling induces focal adhesion and Integrin beta-1 endocytosis. iScience. 2022;25:104123 pubmed publisher
McNamara R, Zhou Y, Eason A, Landis J, Chambers M, Willcox S, et al. Imaging of surface microdomains on individual extracellular vesicles in 3-D. J Extracell Vesicles. 2022;11:e12191 pubmed publisher
Muñiz García A, Romero M, Falcόn Perez J, Murray P, Zorzano A, Mora S. Hypoxia-induced HIF1α activation regulates small extracellular vesicle release in human embryonic kidney cells. Sci Rep. 2022;12:1443 pubmed publisher
Lin J, McCann A, Sereesongsaeng N, Burden J, Alsa d A, Burden R, et al. USP17 is required for peripheral trafficking of lysosomes. EMBO Rep. 2022;23:e51932 pubmed publisher
Strohmeier K, Hofmann M, Hauser F, Sivun D, Puthukodan S, Karner A, et al. CRISPR/Cas9 Genome Editing vs. Over-Expression for Fluorescent Extracellular Vesicle-Labeling: A Quantitative Analysis. Int J Mol Sci. 2021;23: pubmed publisher
Sagini K, Buratta S, Delo F, Pellegrino R, Giovagnoli S, Urbanelli L, et al. Drug-Induced Lysosomal Impairment Is Associated with the Release of Extracellular Vesicles Carrying Autophagy Markers. Int J Mol Sci. 2021;22: pubmed publisher
Tsakaneli A, Carregari V, Morini M, Eva A, Cangemi G, Chayka O, et al. MYC regulates metabolism through vesicular transfer of glycolytic kinases. Open Biol. 2021;11:210276 pubmed publisher
Maeda M, Suzuki M, Takashima S, Sasaki T, Oh hashi K, Takemori H. The new live imagers MitoMM1/2 for mitochondrial visualization. Biochem Biophys Res Commun. 2021;562:50-54 pubmed publisher
Aydin Y, Koksal A, Reddy V, Lin D, Osman H, Heidari Z, et al. Extracellular Vesicle Release Promotes Viral Replication during Persistent HCV Infection. Cells. 2021;10: pubmed publisher
Zhang P, Lim S, Jiang K, Chew T, Low B, Lim C. Distinct mRNAs in Cancer Extracellular Vesicles Activate Angiogenesis and Alter Transcriptome of Vascular Endothelial Cells. Cancers (Basel). 2021;13: pubmed publisher
Yao X, Lyu P, Yoo K, Yadav M, Singh R, Atala A, et al. Engineered extracellular vesicles as versatile ribonucleoprotein delivery vehicles for efficient and safe CRISPR genome editing. J Extracell Vesicles. 2021;10:e12076 pubmed publisher
Zhang Y, Li C, Qin Y, Cepparulo P, Millman M, Chopp M, et al. Small extracellular vesicles ameliorate peripheral neuropathy and enhance chemotherapy of oxaliplatin on ovarian cancer. J Extracell Vesicles. 2021;10:e12073 pubmed publisher
Hall E, Dillard M, Stewart D, Zhang Y, Wagner B, Levine R, et al. Cytoneme delivery of Sonic Hedgehog from ligand-producing cells requires Myosin 10 and a Dispatched-BOC/CDON co-receptor complex. elife. 2021;10: pubmed publisher
Buchroithner B, Mayr S, Hauser F, Priglinger E, Stangl H, Santa Maria A, et al. Dual Channel Microfluidics for Mimicking the Blood-Brain Barrier. ACS Nano. 2021;15:2984-2993 pubmed publisher
Wang Y, Burghardt T, Worrell G, Wang H. The frequency-dependent effect of electrical fields on the mobility of intracellular vesicles in astrocytes. Biochem Biophys Res Commun. 2021;534:429-435 pubmed publisher
Jurgielewicz B, Yao Y, Stice S. Kinetics and Specificity of HEK293T Extracellular Vesicle Uptake using Imaging Flow Cytometry. Nanoscale Res Lett. 2020;15:170 pubmed publisher
Bayer C, Pitschelatow G, Hannemann N, Linde J, Reichard J, Pensold D, et al. DNA Methyltransferase 1 (DNMT1) Acts on Neurodegeneration by Modulating Proteostasis-Relevant Intracellular Processes. Int J Mol Sci. 2020;21: pubmed publisher
Sharda A, Barr A, Harrison J, Wilkie A, Fang C, Mendez L, et al. vWF maturation and release are controlled by two regulators of Weibel-Palade body biogenesis: exocyst and BLOC-2. Blood. 2020;: pubmed publisher
Tian C, Hu G, Gao L, Hackfort B, Zucker I. Extracellular vesicular MicroRNA-27a* contributes to cardiac hypertrophy in chronic heart failure. J Mol Cell Cardiol. 2020;143:120-131 pubmed publisher
Wang L, Chopp M, Szalad A, Lu X, Zhang Y, Wang X, et al. Exosomes Derived From Schwann Cells Ameliorate Peripheral Neuropathy in Type 2 Diabetic Mice. Diabetes. 2020;69:749-759 pubmed publisher
D Agostino M, Scerra G, Cannata Serio M, Caporaso M, Bonatti S, Renna M. Unconventional secretion of α-Crystallin B requires the Autophagic pathway and is controlled by phosphorylation of its serine 59 residue. Sci Rep. 2019;9:16892 pubmed publisher
Pasquier A, Vivot K, Erbs E, Spiegelhalter C, Zhang Z, Aubert V, et al. Lysosomal degradation of newly formed insulin granules contributes to β cell failure in diabetes. Nat Commun. 2019;10:3312 pubmed publisher
D Souza Z, Blackburn J, Kudlyk T, Pokrovskaya I, Lupashin V. Defects in COG-Mediated Golgi Trafficking Alter Endo-Lysosomal System in Human Cells. Front Cell Dev Biol. 2019;7:118 pubmed publisher
Hu G, Liao K, Niu F, Yang L, Dallon B, Callen S, et al. Astrocyte EV-Induced lincRNA-Cox2 Regulates Microglial Phagocytosis: Implications for Morphine-Mediated Neurodegeneration. Mol Ther Nucleic Acids. 2018;13:450-463 pubmed publisher
Nag S, Rani S, Mahanty S, Bissig C, Arora P, Azevedo C, et al. Rab4A organizes endosomal domains for sorting cargo to lysosome-related organelles. J Cell Sci. 2018;131: pubmed publisher
Fukushima M, Dasgupta D, Mauer A, Kakazu E, Nakao K, Malhi H. StAR-related lipid transfer domain 11 (STARD11)-mediated ceramide transport mediates extracellular vesicle biogenesis. J Biol Chem. 2018;293:15277-15289 pubmed publisher
Durso W, D Autilia F, Amodeo R, Marchetti L, Cardarelli F. Probing labeling-induced lysosome alterations in living cells by imaging-derived mean squared displacement analysis. Biochem Biophys Res Commun. 2018;503:2704-2709 pubmed publisher
Sardar Sinha M, Ansell Schultz A, Civitelli L, Hildesjö C, Larsson M, Lannfelt L, et al. Alzheimer's disease pathology propagation by exosomes containing toxic amyloid-beta oligomers. Acta Neuropathol. 2018;136:41-56 pubmed publisher
Chen Y, Fang Y, Cheng Y, Lin C, Hsu L, Wang S, et al. Exophagy of annexin A2 via RAB11, RAB8A and RAB27A in IFN-γ-stimulated lung epithelial cells. Sci Rep. 2017;7:5676 pubmed publisher
Samson E, Tsao D, Zimak J, McLaughlin R, Trenton N, Mace E, et al. The coordinating role of IQGAP1 in the regulation of local, endosome-specific actin networks. Biol Open. 2017;6:785-799 pubmed publisher
product information
Catalog Number :
62964
Product Name :
CD63-pEGFP C2
article :
doi
id9731
pubmed_id
bacterial resistance :
Kanamycin
cloning :
backbonepEGFP C2
backbone_mutation
backbone_originClontech
backbone_size4700
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth notes :
Examples of use: Blagoveshchenskaya AD, Hannah MJ, Allen S, Cutler DF. (2002) Selective and signal-dependent recruitment of membrane proteins to secretory granules formed by heterologously expressed von Willebrand factor. Mol Biol Cell 13:1582-1593. Bampton ET, Goemans CG, Niranjan D, Mizushima N, Tolkovsky AM. (2005) The dynamics of autophagy visualized in live cells: from autophagosome formation to fusion with endo/lysosomes. Autophagy 1: 23-36. Harrison-Lavoie KJ, Michaux G, Hewlett L, Kaur J, Hannah MJ, Lui-Roberts WW, Norman KE, Cutler DF. (2006) P-selectin and CD63 use different mechanisms for delivery to Weibel-Palade bodies. Traffic 7: 647-662. Babich V, Meli A, Knipe L, Dempster JE, Skehel P, Hannah MJ, Carter T. (2008) Selective release of molecules from Weibel-Palade bodies during a lingering kiss. Blood 111: 5282-5290. Babich V, Knipe L, Hewlett L, Meli A, Dempster J, Hannah MJ, Carter T. (2009) Differential effect of extracellular acidosis on the release and dispersal of soluble and membrane proteins secreted from the Weibel-Palade body.
growth strain :
full length human CD63 cloned into pEGFP C2
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3BamHI
cloning_site_5KpnI
promoterCMV
sequencing_primer_35 ACAAACCACAACTAGAATGCAG 3
sequencing_primer_55 CCGACAACCACTACCTGAGC 3
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesAD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30
geneCD63
id967
genbank_ids
NM_001267698.1
mutationCD63 has 1 silent mutation compared to the coding sequence of NM_001267698.1 N129 AAT instead of AAC
nameCD63 molecule
shRNA_sequence
size749
species
9606
Homo sapiens
tags
locationN terminal on backbone
tagEGFP
resistance markers :
2251
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA