This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
Slc17a7-IRES2-Cre targeting vector
catalog :
61574
citations: 2
Reference
Li M, Tan H, Lu Z, Tsang K, Chung A, Zuker C. Gut-brain circuits for fat preference. Nature. 2022;610:722-730 pubmed publisher
Madisen L, Garner A, Shimaoka D, Chuong A, Klapoetke N, Li L, et al. Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Neuron. 2015;85:942-58 pubmed publisher
product information
Catalog Number :
61574
Product Name :
Slc17a7-IRES2-Cre targeting vector
article :
doi10.1016/j.neuron.2015.02.022
id10028
pubmed_id25741722
bacterial resistance :
Ampicillin
cloning :
backboneminimal cloning vector
backbone_mutationMCS region was modified
backbone_origin
backbone_size2657
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mouse Targeting
Cre/Lox
growth notes :
The Zeng lab recommends amplifying this plasmid in 15 microg/ml kanamycin to reduce recombination. Addgene is not able to supply the plasmid under these selection conditions and the stab you receive will be under Amp selection. We recommend using the low conc. Kan selection and checking your plasmid prep for recombination.
growth strain :
Target the Cre recombinase gene to the stop codon of the mouse Slc17a7 (VGlut1) gene
origin :
30
pi :
alt_names
cloning
clone_methodLigation Independent Cloning
cloning_site_3
cloning_site_5
promoter
sequencing_primer_3TTCACACCGCATAGGGTCAT
sequencing_primer_5TCCGTCAGGATGGCCTTCTG
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameSlc17a7-IRES2-Cre
shRNA_sequence
size15587
species
10090
Mus musculus
32644
Other
P1 Bacteriophage
tags
resistance markers :
650
tags :
Low Copy
terms :
Neomycin (select with G418)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA