This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
Pvalb-2A-Cre targeting vector
catalog :
61570
citations: 1
Reference
Madisen L, Garner A, Shimaoka D, Chuong A, Klapoetke N, Li L, et al. Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Neuron. 2015;85:942-58 pubmed publisher
product information
Catalog Number :
61570
Product Name :
Pvalb-2A-Cre targeting vector
article :
doi10.1016/j.neuron.2015.02.022
id10028
pubmed_id25741722
bacterial resistance :
Ampicillin
cloning :
backbonepBS SK2+
backbone_mutationContains a pPGK-DTA-bGHpA cassette, MCS region was modified
backbone_origin
backbone_size4496
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mouse Targeting
Cre/Lox
growth strain :
Target the Cre recombinase gene to the stop codon of the mouse Pvalb gene
origin :
30
pi :
alt_names
Cre
cloning
clone_methodRestriction Enzyme
cloning_site_3Sac2
cloning_site_5Kpn
promoter
sequencing_primer_3AACAGCTATGACCATG
sequencing_primer_5TCTTCGCTATTACGCCAGCT
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namePvalb exon 4 - 2A - Cre
shRNA_sequence
size11973
species
10090
Mus musculus
32644
Other
P1 Bacteriophage
tags
resistance markers :
650
tags :
High Copy
terms :
Neomycin (select with G418)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA