This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pGL4.23 C3_17
catalog :
60300
citations: 1
product information
Catalog Number :
60300
Product Name :
pGL4.23 C3_17
article :
| doi | 10.1038/ng.2870 |
| id | 9083 |
| pubmed_id | 24413736 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pGL4.23-GW | ||
| backbone_mutation | |||
| backbone_origin | Ferrer Lab | ||
| backbone_size | 4283 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
chromosome : chr6; start: 37883250 end: 37883831 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTTCATGTTTCCCCCGTATGT Rv primer used for cloning: TCCTGCCCCAAGTTGCACAG
growth strain :
This plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.
origin :
37
pi :
|
resistance markers :
| 2091 |
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
