This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pENTR D-TOPO-C3_36
catalog :
60277
citations: 1
product information
Catalog Number :
60277
Product Name :
pENTR D-TOPO-C3_36
article :
| doi | 10.1038/ng.2870 |
| id | 9083 |
| pubmed_id | 24413736 |
bacterial resistance :
Kanamycin
cloning :
| backbone | pENTR/D-TOPO | ||
| backbone_mutation | |||
| backbone_origin | Invitrogen | ||
| backbone_size | 2580 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
chromosome : chr2; start: 25333263 end: 25333884 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGCAGTGTGGGCTAGAGCATC Rv primer used for cloning: GACCCCCACTTCTCTCCCTCCAGA
growth strain :
This plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.
origin :
37
pi :
|
resistance markers :
| 2091 |
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
