This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLentiCMV Puro DEST ERKKTRClover
catalog :
59150
citations: 36
Reference
Zhou W, Ryan A, Janosko C, Shoger K, Haugh J, Gottschalk R, et al. Isoform-specific optical activation of kinase function reveals p38-ERK signaling crosstalk. RSC Chem Biol. 2023;4:765-773 pubmed publisher
Hyeon B, Lee H, Kim N, Heo W. Optogenetic dissection of RET signaling reveals robust activation of ERK and enhanced filopodia-like protrusions of regenerating axons. Mol Brain. 2023;16:56 pubmed publisher
Rahman S, Haugh J. On the inference of ERK signaling dynamics from protein biosensor measurements. Mol Biol Cell. 2023;34:ar60 pubmed publisher
Chen Z, He Q, Lu T, Wu J, Shi G, He L, et al. mcPGK1-dependent mitochondrial import of PGK1 promotes metabolic reprogramming and self-renewal of liver TICs. Nat Commun. 2023;14:1121 pubmed publisher
Hanson R, Batchelor E. Coordination of MAPK and p53 dynamics in the cellular responses to DNA damage and oxidative stress. Mol Syst Biol. 2022;18:e11401 pubmed publisher
Bondarev N, Ivanenko K, Khabusheva E, Lebedev T, Manukhov I, Prassolov V. MGL S3 Chimeric Enzyme Drives Apoptotic Death of EGFR-Dependent Cancer Cells through ERK Downregulation. Int J Mol Sci. 2022;23: pubmed publisher
Stern A, Smith G, Santos L, Sarmah D, Zhang X, Lu X, et al. Relating individual cell division events to single-cell ERK and Akt activity time courses. Sci Rep. 2022;12:18077 pubmed publisher
Lebedev T, Buzdin A, Khabusheva E, Spirin P, Suntsova M, Sorokin M, et al. Subtype of Neuroblastoma Cells with High KIT Expression Are Dependent on KIT and Its Knockdown Induces Compensatory Activation of Pro-Survival Signaling. Int J Mol Sci. 2022;23: pubmed publisher
Lebedev T, Khabusheva E, Mareeva S, Ivanenko K, Morozov A, Spirin P, et al. Identification of cell type-specific correlations between ERK activity and cell viability upon treatment with ERK1/2 inhibitors. J Biol Chem. 2022;:102226 pubmed publisher
Qi J, Rittershaus A, Priya R, Mansingh S, Stainier D, Helker C. Apelin signaling dependent endocardial protrusions promote cardiac trabeculation in zebrafish. elife. 2022;11: pubmed publisher
Kamada H, Yasuhira S, Shibazaki M, Amano H, Maesawa C. DUSP4 Inactivation Leads to Reduced Extracellular Signal‒Regulated Kinase Activity through Upregulation of DUSP6 in Melanoma Cells. J Invest Dermatol. 2022;: pubmed publisher
Lebedev T, Vagapova E, Prassolov V. The Different Impact of ERK Inhibition on Neuroblastoma, Astrocytoma, and Rhabdomyosarcoma Cell Differentiation. Acta Naturae. 2021;13:69-77 pubmed publisher
Vagapova E, Kozlov M, Lebedev T, Ivanenko K, Leonova O, Popenko V, et al. Selective Inhibition of HDAC Class I Sensitizes Leukemia and Neuroblastoma Cells to Anticancer Drugs. Biomedicines. 2021;9: pubmed publisher
Yang J, Chi W, Liang J, Takayanagi S, Iglesias P, Huang C. Deciphering cell signaling networks with massively multiplexed biosensor barcoding. Cell. 2021;184:6193-6206.e14 pubmed publisher
Krause H, Bondarowicz H, Karls A, McClean M, Kreeger P. Design and implementation of a microfluidic device capable of temporal growth factor delivery reveal filtering capabilities of the EGFR/ERK pathway. APL Bioeng. 2021;5:046101 pubmed publisher
Katsuno Kambe H, Teo J, Ju R, Hudson J, Stehbens S, Yap A. Collagen polarization promotes epithelial elongation by stimulating locoregional cell proliferation. elife. 2021;10: pubmed publisher
Lebedev T, Vagapova E, Spirin P, Rubtsov P, Astashkova O, Mikheeva A, et al. Growth factor signaling predicts therapy resistance mechanisms and defines neuroblastoma subtypes. Oncogene. 2021;40:6258-6272 pubmed publisher
Ghilardi S, Aronson M, Sgro A. Ventral stress fibers induce plasma membrane deformation in human fibroblasts. Mol Biol Cell. 2021;32:1707-1723 pubmed publisher
Vagapova E, Lebedev T, Prassolov V. Viral fibrotic scoring and drug screen based on MAPK activity uncovers EGFR as a key regulator of COVID-19 fibrosis. Sci Rep. 2021;11:11234 pubmed publisher
Li R, Ng T, Wang S, Prytyskach M, Rodell C, Mikula H, et al. Therapeutically reprogrammed nutrient signalling enhances nanoparticulate albumin bound drug uptake and efficacy in KRAS-mutant cancer. Nat Nanotechnol. 2021;16:830-839 pubmed publisher
Anson K, Corbet G, Palmer A. Zn2+ influx activates ERK and Akt signaling pathways. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Zhan H, Bhattacharya S, Cai H, Iglesias P, Huang C, Devreotes P. An Excitable Ras/PI3K/ERK Signaling Network Controls Migration and Oncogenic Transformation in Epithelial Cells. Dev Cell. 2020;54:608-623.e5 pubmed publisher
Luthria G, Li R, Wang S, Prytyskach M, Kohler R, Lauffenburger D, et al. In vivo microscopy reveals macrophage polarization locally promotes coherent microtubule dynamics in migrating cancer cells. Nat Commun. 2020;11:3521 pubmed publisher
Inde Z, Forcina G, Denton K, Dixon S. Kinetic Heterogeneity of Cancer Cell Fractional Killing. Cell Rep. 2020;32:107845 pubmed publisher
Wang S, Li R, Ng T, Luthria G, Oudin M, Prytyskach M, et al. Efficient blockade of locally reciprocated tumor-macrophage signaling using a TAM-avid nanotherapy. Sci Adv. 2020;6:eaaz8521 pubmed publisher
Rahman S, Zhou W, Deiters A, Haugh J. Optical control of MAP kinase kinase 6 (MKK6) reveals that it has divergent roles in pro-apoptotic and anti-proliferative signaling. J Biol Chem. 2020;295:8494-8504 pubmed publisher
Hermida M, Kumar J, Schwarz D, Laverty K, Di Bartolo A, Ardron M, et al. Three dimensional in vitro models of cancer: Bioprinting multilineage glioblastoma models. Adv Biol Regul. 2020;75:100658 pubmed publisher
Courtney T, Deiters A. Optical control of protein phosphatase function. Nat Commun. 2019;10:4384 pubmed publisher
Sang D, Pinglay S, Wiewiora R, Selvan M, Lou H, Chodera J, et al. Ancestral reconstruction reveals mechanisms of ERK regulatory evolution. elife. 2019;8: pubmed publisher
Humphries B, Buschhaus J, Chen Y, Haley H, Qyli T, Chiang B, et al. Plasminogen Activator Inhibitor 1 (PAI1) Promotes Actin Cytoskeleton Reorganization and Glycolytic Metabolism in Triple-Negative Breast Cancer. Mol Cancer Res. 2019;17:1142-1154 pubmed publisher
Kim J, Lee S, Jung K, Oh W, Kim N, Son S, et al. Intensiometric biosensors visualize the activity of multiple small GTPases in vivo. Nat Commun. 2019;10:211 pubmed publisher
Yang J, Bhattacharya S, West Foyle H, Hung C, Wu T, Iglesias P, et al. Integrating chemical and mechanical signals through dynamic coupling between cellular protrusions and pulsed ERK activation. Nat Commun. 2018;9:4673 pubmed publisher
Goglia A, Wilson M, DiGiorno D, Toettcher J. Optogenetic Control of Ras/Erk Signaling Using the Phy-PIF System. Methods Mol Biol. 2017;1636:3-20 pubmed publisher
Jung S, Kushmerick C, Seo J, Koh D, Hille B. Muscarinic receptor regulates extracellular signal regulated kinase by two modes of arrestin binding. Proc Natl Acad Sci U S A. 2017;114:E5579-E5588 pubmed publisher
Park H, Kim N, Lee S, Kim N, Kim J, Heo W. Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2. Nat Commun. 2017;8:30 pubmed publisher
Regot S, Hughey J, Bajar B, Carrasco S, Covert M. High-sensitivity measurements of multiple kinase activities in live single cells. Cell. 2014;157:1724-34 pubmed publisher
product information
Catalog Number :
59150
Product Name :
pLentiCMV Puro DEST ERKKTRClover
article :
doi10.1016/j.cell.2014.04.039
id8818
pubmed_id24949979
bacterial resistance :
Ampicillin
cloning :
backbonepLenti CMV Puro DEST (w118-1)
backbone_mutation
backbone_originEric Campeau Lab (Addgene Plasmid 17452)
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
growth strain :
Lentiviral vector to express ERK KTR mClover under CMV promoter (With Puromycin Resistance)
origin :
30
pi :
alt_names
cloning
clone_methodGateway Cloning
cloning_site_3
cloning_site_5
promoterCMV
sequencing_primer_3
sequencing_primer_5CGTCGCCGTCCAGCTCGACCAG
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameERK Kinase Translocation Reporter
shRNA_sequence
size
species
tags
resistance markers :
2033
tags :
Unknown
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA