This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCW-Cas9
catalog :
50661
citations: 162
Reference
Hauck J, Moon D, Jiang X, Wang M, Zhao Y, Xu L, et al. Heat shock factor 1 directly regulates transsulfuration pathway to promote prostate cancer proliferation and survival. Commun Biol. 2024;7:9 pubmed publisher
Ludzki A, Hansen M, Zareifi D, Jalkanen J, Huang Z, Omar Hmeadi M, et al. Transcriptional determinants of lipid mobilization in human adipocytes. Sci Adv. 2024;10:eadi2689 pubmed publisher
Yang X, Gu C, Cai J, Li F, He X, Luo L, et al. Excessive SOX8 reprograms energy and iron metabolism to prime hepatocellular carcinoma for ferroptosis. Redox Biol. 2023;69:103002 pubmed publisher
Chen Z, Wang X, Gao X, Arslanovic N, Chen K, Tyler J. Transcriptional inhibition after irradiation occurs preferentially at highly expressed genes in a manner dependent on cell cycle progression. bioRxiv. 2023;: pubmed publisher
Boichuk S, Dunaev P, Skripova V, Galembikova A, Bikinieva F, Shagimardanova E, et al. Unraveling the Mechanisms of Sensitivity to Anti-FGF Therapies in Imatinib-Resistant Gastrointestinal Stromal Tumors (GIST) Lacking Secondary KIT Mutations. Cancers (Basel). 2023;15: pubmed publisher
Wilson G, Vuina K, Sava G, Huard C, Meneguello L, Coulombe Huntington J, et al. Active growth signaling promotes senescence and cancer cell sensitivity to CDK7 inhibition. Mol Cell. 2023;83:4078-4092.e6 pubmed publisher
Herrera L, Johnson R, McGlynn K, Gibbs Z, Davis A, Whitehurst A. The cancer testes antigen, HORMAD1, limits genomic instability in cancer cells by protecting stalled replication forks. J Biol Chem. 2023;299:105348 pubmed publisher
Ren R, Hua Y, Wang H. Protocol to capture transcription factor-mediated 3D chromatin interactions using affinity tag-based BL-HiChIP. STAR Protoc. 2023;4:102589 pubmed publisher
Schneider P, Wander P, Arentsen Peters S, Vrenken K, Rockx Brouwer D, Adriaanse F, et al. CRISPR-Cas9 Library Screening Identifies Novel Molecular Vulnerabilities in KMT2A-Rearranged Acute Lymphoblastic Leukemia. Int J Mol Sci. 2023;24: pubmed publisher
Hatzold J, Nett V, Brantsch S, Zhang J, Armistead J, Wessendorf H, et al. Matriptase-dependent epidermal pre-neoplasm in zebrafish embryos caused by a combination of hypotonic stress and epithelial polarity defects. PLoS Genet. 2023;19:e1010873 pubmed publisher
Di Meo F, Iyer A, AKAMA K, Cheng R, Yu C, Cesarano A, et al. A target discovery pipeline identified ILT3 as a target for immunotherapy of multiple myeloma. Cell Rep Med. 2023;4:101110 pubmed publisher
Menolfi D, Lee B, Zhang H, Jiang W, Bowen N, Wang Y, et al. ATR kinase supports normal proliferation in the early S phase by preventing replication resource exhaustion. bioRxiv. 2023;: pubmed publisher
Guerrero Santoro J, Morizane M, Oh S, Mishima T, Goff J, Bildirici I, et al. The lipase cofactor CGI58 controls placental lipolysis. JCI Insight. 2023;8: pubmed publisher
Harbour J, Kurtenbach S, Sanchez M, Kuznetsoff J, Rodriguez D, Weich N, et al. PRAME induces genomic instability in uveal melanoma. Res Sq. 2023;: pubmed publisher
Wang X, Wang B, Li F, Li X, Guo T, Gao Y, et al. The c-Src/LIST Positive Feedback Loop Sustains Tumor Progression and Chemoresistance. Adv Sci (Weinh). 2023;10:e2300115 pubmed publisher
Guo L, Mao Q, He J, Liu X, Piao X, Luo L, et al. Disruption of ER ion homeostasis maintained by an ER anion channel CLCC1 contributes to ALS-like pathologies. Cell Res. 2023;33:497-515 pubmed publisher
Schrenk S, Bischoff L, Goines J, Cai Y, Vemaraju S, Odaka Y, et al. MEK inhibition reduced vascular tumor growth and coagulopathy in a mouse model with hyperactive GNAQ. Nat Commun. 2023;14:1929 pubmed publisher
van de Kooij B, de Vries E, Rooswinkel R, Janssen G, Kok F, van Veelen P, et al. N-terminal acetylation can stabilize proteins independent of their ubiquitination. Sci Rep. 2023;13:5333 pubmed publisher
Zhang L, He W, Fu R, Xu H. Guide-specific loss of efficiency and off-target reduction with Cas9 variants. bioRxiv. 2023;: pubmed publisher
Yan C, Meng Y, Yang J, Chen J, Jiang W. Translational landscape in human early neural fate determination. Development. 2023;150: pubmed publisher
Parker S, Ly K, Grant A, Sweetland J, Wang A, Parker J, et al. EVL and MIM/MTSS1 regulate actin cytoskeletal remodeling to promote dendritic filopodia in neurons. J Cell Biol. 2023;222: pubmed publisher
Itah Z, Chaudhry S, Raju Ponny S, Aydemir O, Lee A, Cavanagh Kyros J, et al. HER2-driven breast cancer suppression by the JNK signaling pathway. Proc Natl Acad Sci U S A. 2023;120:e2218373120 pubmed publisher
Ratnayeke N, Baris Y, Chung M, Yeeles J, Meyer T. CDT1 inhibits CMG helicase in early S phase to separate origin licensing from DNA synthesis. Mol Cell. 2023;83:26-42.e13 pubmed publisher
Sun X, Klingbeil O, Lu B, Wu C, Ballon C, Ouyang M, et al. BRD8 maintains glioblastoma by epigenetic reprogramming of the p53 network. Nature. 2023;613:195-202 pubmed publisher
M xfc ller F, Lim J, Bebber C, Seidel E, Tishina S, Dahlhaus A, et al. Elevated FSP1 protects KRAS-mutated cells from ferroptosis during tumor initiation. Cell Death Differ. 2022;: pubmed publisher
Zhang I, Liu S, Zhang L, Liang R, Fang Q, Zhao J, et al. RAGE Ablation Attenuates Glioma Progression and Enhances Tumor Immune Responses by Suppressing Galectin-3 Expression. Neuro Oncol. 2022;: pubmed publisher
Zhao X, Fang K, Liu X, Yao R, Wang M, Li F, et al. QSER1 preserves the suppressive status of the pro-apoptotic genes to prevent apoptosis. Cell Death Differ. 2022;: pubmed publisher
Zhang Y, He F, Zhang Y, Dai Q, Li Q, Nan J, et al. Exploration of the regulatory relationship between KRAB-Zfp clusters and their target transposable elements via a gene editing strategy at the cluster specific linker-associated sequences by CRISPR-Cas9. Mob DNA. 2022;13:25 pubmed publisher
Clark K, Kim J, Wang Q, Gao H, Presti R, Shan L. Chemical inhibition of DPP9 sensitizes the CARD8 inflammasome in HIV-1-infected cells. Nat Chem Biol. 2022;: pubmed publisher
Gopinathan Nair A, Rabas N, Lejon S, Homiski C, Osborne M, Cyr N, et al. Unorthodox PCNA Binding by Chromatin Assembly Factor 1. Int J Mol Sci. 2022;23: pubmed publisher
Friskes A, Koob L, Krenning L, Severson T, Koeleman E, Vergara X, et al. Double-strand break toxicity is chromatin context independent. Nucleic Acids Res. 2022;50:9930-9947 pubmed publisher
Metselaar D, du Chatinier A, Meel M, Ter Huizen G, Waranecki P, Goulding J, et al. AURKA and PLK1 inhibition selectively and synergistically block cell cycle progression in diffuse midline glioma. iScience. 2022;25:104398 pubmed publisher
Fowler F, Chen B, Zolnerowich N, Wu W, Pavani R, Paiano J, et al. DNA-PK promotes DNA end resection at DNA double strand breaks in G0 cells. elife. 2022;11: pubmed publisher
Carter R, Milani M, Beckett A, Liu S, Prior I, Cohen G, et al. Novel roles of RTN4 and CLIMP-63 in regulating mitochondrial structure, bioenergetics and apoptosis. Cell Death Dis. 2022;13:436 pubmed publisher
Alborzinia H, Flórez A, Kreth S, Brückner L, Yildiz U, Gartlgruber M, et al. MYCN mediates cysteine addiction and sensitizes neuroblastoma to ferroptosis. Nat Cancer. 2022;3:471-485 pubmed publisher
Moser Katz T, Gavile C, Barwick B, Lee K, Boise L. PDZ Proteins SCRIB and DLG1 Regulate Myeloma Cell Surface CD86 Expression, Growth, and Survival. Mol Cancer Res. 2022;20:1122-1136 pubmed publisher
Gugnoni M, Manzotti G, Vitale E, Sauta E, Torricelli F, Reggiani F, et al. OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer. J Exp Clin Cancer Res. 2022;41:108 pubmed publisher
Ferreira J, da Rosa Soares A, Ramalho J, M xe1 ximo Carvalho C, Cardoso M, Pintado P, et al. LAMP2A regulates the loading of proteins into exosomes. Sci Adv. 2022;8:eabm1140 pubmed publisher
Wander P, Arentsen Peters S, Vrenken K, Pinhanҫos S, Koopmans B, Dolman M, et al. High-Throughput Drug Library Screening in Primary KMT2A-Rearranged Infant ALL Cells Favors the Identification of Drug Candidates That Activate P53 Signaling. Biomedicines. 2022;10: pubmed publisher
Blaha C, Ramakrishnan G, Jeon S, Nogueira V, Rho H, Kang S, et al. A non-catalytic scaffolding activity of hexokinase 2 contributes to EMT and metastasis. Nat Commun. 2022;13:899 pubmed publisher
Kim K, Kabra A, Kim D, Xue Y, Huang Y, Hou P, et al. KIX domain determines a selective tumor-promoting role for EP300 and its vulnerability in small cell lung cancer. Sci Adv. 2022;8:eabl4618 pubmed publisher
Fu R, He W, Dou J, Villarreal O, Bedford E, Wang H, et al. Systematic decomposition of sequence determinants governing CRISPR/Cas9 specificity. Nat Commun. 2022;13:474 pubmed publisher
Chen Q, Ma K, Liu X, Chen S, Li P, Yu Y, et al. Truncated PARP1 mediates ADP-ribosylation of RNA polymerase III for apoptosis. Cell Discov. 2022;8:3 pubmed publisher
Tang C, Clark O, Ferrarone J, Campos C, Lalani A, Chodera J, et al. GCN2 kinase activation by ATP-competitive kinase inhibitors. Nat Chem Biol. 2021;: pubmed publisher
Rauner G, Jin D, Miller D, Gierahn T, Li C, Sokol E, et al. Breast tissue regeneration is driven by cell-matrix interactions coordinating multi-lineage stem cell differentiation through DDR1. Nat Commun. 2021;12:7116 pubmed publisher
Rashkovan M, Albero R, Gianni F, Pérez Durán P, Miller H, Mackey A, et al. Intracellular cholesterol pools regulate oncogenic signaling and epigenetic circuitries in Early T-cell Precursor Acute Lymphoblastic Leukemia. Cancer Discov. 2021;: pubmed publisher
Yu L, Zhou D, Zhang G, Ren Z, Luo X, Liu P, et al. Co-occurrence of BAP1 and SF3B1 mutations in uveal melanoma induces cellular senescence. Mol Oncol. 2021;: pubmed publisher
Kumar R, Mendonca J, Owoyemi O, Boyapati K, Thomas N, Kanacharoen S, et al. Supraphysiologic Testosterone Induces Ferroptosis and Activates Immune Pathways through Nucleophagy in Prostate Cancer. Cancer Res. 2021;81:5948-5962 pubmed publisher
Qu H, Zhu Y. SMPDL3B Predicts Poor Prognosis and Contributes to Development of Acute Myeloid Leukemia. Front Mol Biosci. 2021;8:695601 pubmed publisher
Chen B, Wang Y, Shen Z, Bennett A, Hindi I, Tyler J, et al. The RNF8 and RNF168 Ubiquitin Ligases Regulate Pro- and Anti-Resection Activities at Broken DNA Ends During Non-Homologous End Joining. DNA Repair (Amst). 2021;108:103217 pubmed publisher
Chen B, Wang Y, Tubbs A, Zong D, Fowler F, Zolnerowich N, et al. LIN37-DREAM prevents DNA end resection and homologous recombination at DNA double-strand breaks in quiescent cells. elife. 2021;10: pubmed publisher
Xu C, Meng F, Park K, Storey A, Gong W, Tsai Y, et al. A NSD3-targeted PROTAC suppresses NSD3 and cMyc oncogenic nodes in cancer cells. Cell Chem Biol. 2021;: pubmed publisher
Fan Y, Meyer T. Molecular control of cell density-mediated exit to quiescence. Cell Rep. 2021;36:109436 pubmed publisher
Chiu Y, Medina C, Doyle C, Zhou M, Narahari A, Sandilos J, et al. Deacetylation as a receptor-regulated direct activation switch for pannexin channels. Nat Commun. 2021;12:4482 pubmed publisher
Butler M, van Ingen Schenau D, Yu J, Jenni S, Dobay M, Hagelaar R, et al. BTK inhibition sensitizes Acute Lymphoblastic Leukemia to asparaginase by suppressing the Amino Acid Response pathway. Blood. 2021;: pubmed publisher
Santoliquido B, Frenquelli M, Contadini C, Bestetti S, Gaviraghi M, Barbieri E, et al. Deletion of a pseudogene within a fragile site triggers the oncogenic expression of the mitotic CCSER1 gene. Life Sci Alliance. 2021;4: pubmed publisher
Ganga A, Kennedy M, Oguchi M, Gray S, Oliver K, Knight T, et al. Rab34 GTPase mediates ciliary membrane formation in the intracellular ciliogenesis pathway. Curr Biol. 2021;31:2895-2905.e7 pubmed publisher
Monserrat J, Morales Torres C, Richardson L, Wilson T, Patel H, Domart M, et al. Disruption of the MSL complex inhibits tumour maintenance by exacerbating chromosomal instability. Nat Cell Biol. 2021;23:401-412 pubmed publisher
Al Masri M, Paliotti K, Tran R, Halaoui R, Lelarge V, Chatterjee S, et al. Architectural control of metabolic plasticity in epithelial cancer cells. Commun Biol. 2021;4:371 pubmed publisher
Yamamoto S, Yabuki R, Kitagawa D. Biophysical and biochemical properties of Deup1 self-assemblies: a potential driver for deuterosome formation during multiciliogenesis. Biol Open. 2021;10: pubmed publisher
Gupta V, Barwick B, Matulis S, Shirasaki R, Jaye D, Keats J, et al. Venetoclax sensitivity in multiple myeloma is associated with B-cell gene expression. Blood. 2021;137:3604-3615 pubmed publisher
Barua R, Mizuno K, Tashima Y, Ogawa M, Takeuchi H, Taguchi A, et al. Bioinformatics and Functional Analyses Implicate Potential Roles for EOGT and L-fringe in Pancreatic Cancers. Molecules. 2021;26: pubmed publisher
Qiu Y, Ding Q. Optimized protocol for gene editing in adipocytes using CRISPR-Cas9 technology. STAR Protoc. 2021;2:100307 pubmed publisher
Shin H, See J, Kweon J, Kim H, Sung G, Park S, et al. Small-molecule inhibitors of histone deacetylase improve CRISPR-based adenine base editing. Nucleic Acids Res. 2021;: pubmed publisher
Sun W, Tyurin V, Mikulska Ruminska K, Shrivastava I, Anthonymuthu T, Zhai Y, et al. Phospholipase iPLA2β averts ferroptosis by eliminating a redox lipid death signal. Nat Chem Biol. 2021;: pubmed publisher
Niekamp P, Guzman G, Leier H, Rashidfarrokhi A, Richina V, Pott F, et al. Sphingomyelin Biosynthesis Is Essential for Phagocytic Signaling during Mycobacterium tuberculosis Host Cell Entry. MBio. 2021;12: pubmed publisher
Li T, Li X, Zamani A, Wang W, Lee C, Li M, et al. c-Rel Is a Myeloid Checkpoint for Cancer Immunotherapy. Nat Cancer. 2020;1:507-517 pubmed publisher
Chang J, Go S, Gilglioni E, Duijst S, Panneman D, Rodenburg R, et al. Soluble adenylyl cyclase regulates the cytosolic NADH/NAD+ redox state and the bioenergetic switch between glycolysis and oxidative phosphorylation. Biochim Biophys Acta Bioenerg. 2021;1862:148367 pubmed publisher
Xu X, Crow M, Rice B, Li F, Harris B, Liu L, et al. Single-cell RNA sequencing of developing maize ears facilitates functional analysis and trait candidate gene discovery. Dev Cell. 2021;: pubmed publisher
Shoshani O, Brunner S, Yaeger R, Ly P, Nechemia Arbely Y, Kim D, et al. Chromothripsis drives the evolution of gene amplification in cancer. Nature. 2020;: pubmed publisher
Kim J, Lee H, Cai F, Ko B, Yang C, Lieu E, et al. The hexosamine biosynthesis pathway is a targetable liability in KRAS/LKB1 mutant lung cancer. Nat Metab. 2020;2:1401-1412 pubmed publisher
Beharier O, Tyurin V, Goff J, Guerrero Santoro J, Kajiwara K, Chu T, et al. PLA2G6 guards placental trophoblasts against ferroptotic injury. Proc Natl Acad Sci U S A. 2020;117:27319-27328 pubmed publisher
Fazeli P, Zhang Y, O Keefe J, Pesaresi T, Lun M, Lawney B, et al. Prolonged fasting drives a program of metabolic inflammation in human adipose tissue. Mol Metab. 2020;42:101082 pubmed publisher
Brandt M, Gokden A, Ziosi M, Lappalainen T. A polyclonal allelic expression assay for detecting regulatory effects of transcript variants. Genome Med. 2020;12:79 pubmed publisher
Zhu J, Jillette N, Li X, Cheng A, Lau C. C11orf95-RELA reprograms 3D epigenome in supratentorial ependymoma. Acta Neuropathol. 2020;140:951-960 pubmed publisher
Thongthip S, Conti B, Lach F, Smogorzewska A. Suppression of non-homologous end joining does not rescue DNA repair defects in Fanconi anemia patient cells. Cell Cycle. 2020;19:2553-2561 pubmed publisher
Manzano M, Gunther T, Ju H, Nicholas J, Bartom E, Grundhoff A, et al. Kaposi's Sarcoma-Associated Herpesvirus Drives a Super-Enhancer-Mediated Survival Gene Expression Program in Primary Effusion Lymphoma. MBio. 2020;11: pubmed publisher
Feng M, Bai Y, Chen Y, Wang K. Knockout of the Transducin-Like Enhancer of Split 6 Gene Affects the Proliferation and Cell Cycle Process of Mouse Spermatogonia. Int J Mol Sci. 2020;21: pubmed publisher
Sharma G, Ojha R, Noguera Ortega E, Rebecca V, Attanasio J, Liu S, et al. PPT1 inhibition enhances the antitumor activity of anti-PD-1 antibody in melanoma. JCI Insight. 2020;5: pubmed publisher
Li X, Luo G, Li T, Sun H, Wang W, Eiler E, et al. The c-Rel-c-Myc axis controls metabolism and proliferation of human T leukemia cells. Mol Immunol. 2020;125:115-122 pubmed publisher
Tao W, Chu C, Zhou W, Huang Z, Zhai K, Fang X, et al. Dual Role of WISP1 in maintaining glioma stem cells and tumor-supportive macrophages in glioblastoma. Nat Commun. 2020;11:3015 pubmed publisher
Abdisalaam S, Bhattacharya S, Mukherjee S, Sinha D, Srinivasan K, Zhu M, et al. Dysfunctional telomeres trigger cellular senescence mediated by cyclic GMP-AMP synthase. J Biol Chem. 2020;295:11144-11160 pubmed publisher
Bo Y, Qiu S, Mulloy R, Côté M. Filoviruses use the HOPS complex and UVRAG to traffic to Niemann-Pick C1 compartments during viral entry. J Virol. 2020;: pubmed publisher
Witschen P, Chaffee T, Brady N, Huggins D, Knutson T, LaRue R, et al. Tumor Cell Associated Hyaluronan-CD44 Signaling Promotes Pro-Tumor Inflammation in Breast Cancer. Cancers (Basel). 2020;12: pubmed publisher
Singhal J, Chikara S, Horne D, Awasthi S, Salgia R, Singhal S. Targeting RLIP with CRISPR/Cas9 controls tumor growth. Carcinogenesis. 2020;: pubmed publisher
Rickman K, Noonan R, Lach F, Sridhar S, Wang A, Abhyankar A, et al. Distinct roles of BRCA2 in replication fork protection in response to hydroxyurea and DNA interstrand cross-links. Genes Dev. 2020;34:832-846 pubmed publisher
Chiu Y, Hori Y, Ebinuma I, Sato H, Hara N, Ikeuchi T, et al. Identification of calcium and integrin-binding protein 1 as a novel regulator of production of amyloid β peptide using CRISPR/Cas9-based screening system. FASEB J. 2020;34:7661-7674 pubmed publisher
Przanowska R, Sobierajska E, Su Z, Jensen K, Przanowski P, Nagdas S, et al. miR-206 family is important for mitochondrial and muscle function, but not essential for myogenesis in vitro. FASEB J. 2020;34:7687-7702 pubmed publisher
Orge I, Gadd V, Barouh J, Rossi E, Carvalho R, Smith I, et al. Phenotype instability of hepatocyte-like cells produced by direct reprogramming of mesenchymal stromal cells. Stem Cell Res Ther. 2020;11:154 pubmed publisher
Drescher F, Juarez P, Arellano D, Serafín Higuera N, Olvera Rodriguez F, Jiménez S, et al. TIE2 Induces Breast Cancer Cell Dormancy and Inhibits the Development of Osteolytic Bone Metastases. Cancers (Basel). 2020;12: pubmed publisher
Loe T, Li J, Zhang Y, Azeroglu B, BODDY M, Denchi E. Telomere length heterogeneity in ALT cells is maintained by PML-dependent localization of the BTR complex to telomeres. Genes Dev. 2020;34:650-662 pubmed publisher
Cawte A, Unrau P, Rueda D. Live cell imaging of single RNA molecules with fluorogenic Mango II arrays. Nat Commun. 2020;11:1283 pubmed publisher
Bajpai R, Sharma A, Achreja A, Edgar C, Wei C, Siddiqa A, et al. Electron transport chain activity is a predictor and target for venetoclax sensitivity in multiple myeloma. Nat Commun. 2020;11:1228 pubmed publisher
Chan A, Huber A, Lamia K. Cryptochromes modulate E2F family transcription factors. Sci Rep. 2020;10:4077 pubmed publisher
Zhou N, Zhang X, Chen C, Chen X, Kang B, He J, et al. Cellular context- and protein level-dependent interaction of pluripotency factor OCT4A with multiple octamer motifs of the same target gene. Life Sci. 2020;248:117461 pubmed publisher
Kobayashi S, Yoshii K, Phongphaew W, Muto M, Hirano M, Orba Y, et al. West Nile virus capsid protein inhibits autophagy by AMP-activated protein kinase degradation in neurological disease development. PLoS Pathog. 2020;16:e1008238 pubmed publisher
Bai Y, Zhu C, Feng M, Pan B, Zhang S, Zhan X, et al. Establishment of A Reversibly Inducible Porcine Granulosa Cell Line. Cells. 2020;9: pubmed publisher
Serçin O, Reither S, Roidos P, Ballin N, Palikyras S, Baginska A, et al. A solid-phase transfection platform for arrayed CRISPR screens. Mol Syst Biol. 2019;15:e8983 pubmed publisher
Peng Y, Yang T, Tang X, Chen F, Wang S. Construction of an Inducible CRISPR/Cas9 System for CXCR4 Gene and Demonstration of its Effects on MKN-45 Cells. Cell Biochem Biophys. 2019;: pubmed publisher
Hoang H, Graber T, Jia J, Vaidya N, Gilchrist V, Xiang X, et al. Induction of an Alternative mRNA 5' Leader Enhances Translation of the Ciliopathy Gene Inpp5e and Resistance to Oncolytic Virus Infection. Cell Rep. 2019;29:4010-4023.e5 pubmed publisher
Chylinski K, Hubmann M, Hanna R, Yanchus C, Michlits G, Uijttewaal E, et al. CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Nat Commun. 2019;10:5454 pubmed publisher
Price J, Russo D, Ji D, Chavez R, DiPeso L, Lee A, et al. IRG1 and Inducible Nitric Oxide Synthase Act Redundantly with Other Interferon-Gamma-Induced Factors To Restrict Intracellular Replication of Legionella pneumophila. MBio. 2019;10: pubmed publisher
Driehuis E, Spelier S, Beltrán Hernández I, de Bree R, M Willems S, Clevers H, et al. Patient-Derived Head and Neck Cancer Organoids Recapitulate EGFR Expression Levels of Respective Tissues and Are Responsive to EGFR-Targeted Photodynamic Therapy. J Clin Med. 2019;8: pubmed publisher
Matreyek K, Stephany J, Chiasson M, Hasle N, Fowler D. An improved platform for functional assessment of large protein libraries in mammalian cells. Nucleic Acids Res. 2019;: pubmed publisher
Gul N, Karlsson J, Tängemo C, Linsefors S, Tuyizere S, Perkins R, et al. The MTH1 inhibitor TH588 is a microtubule-modulating agent that eliminates cancer cells by activating the mitotic surveillance pathway. Sci Rep. 2019;9:14667 pubmed publisher
Purman C, Collins P, Porter S, Saini A, Gupta H, Sleckman B, et al. Regional Gene Repression by DNA Double-Strand Breaks in G1 Phase Cells. Mol Cell Biol. 2019;39: pubmed publisher
Kuznetsov J, Agüero T, Owens D, Kurtenbach S, Field M, Durante M, et al. BAP1 regulates epigenetic switch from pluripotency to differentiation in developmental lineages giving rise to BAP1-mutant cancers. Sci Adv. 2019;5:eaax1738 pubmed publisher
Merola J, Reschke M, Pierce R, Qin L, Spindler S, Baltazar T, et al. Progenitor-derived human endothelial cells evade alloimmunity by CRISPR/Cas9-mediated complete ablation of MHC expression. JCI Insight. 2019;4: pubmed publisher
Meyer S, Scuoppo C, Vlasevska S, Bal E, Holmes A, Holloman M, et al. Unique and Shared Epigenetic Programs of the CREBBP and EP300 Acetyltransferases in Germinal Center B Cells Reveal Targetable Dependencies in Lymphoma. Immunity. 2019;51:535-547.e9 pubmed publisher
Thiem A, Hesbacher S, Kneitz H, di Primio T, Heppt M, Hermanns H, et al. IFN-gamma-induced PD-L1 expression in melanoma depends on p53 expression. J Exp Clin Cancer Res. 2019;38:397 pubmed publisher
Bayles I, Krajewska M, Pontius W, Saiakhova A, Morrow J, Bartels C, et al. Ex vivo screen identifies CDK12 as a metastatic vulnerability in osteosarcoma. J Clin Invest. 2019;129:4377-4392 pubmed publisher
Leick K, Rodriguez A, Melssen M, Benamar M, Lindsay R, Eki R, et al. The Barrier Molecules Junction Plakoglobin, Filaggrin, and Dystonin Play Roles in Melanoma Growth and Angiogenesis. Ann Surg. 2019;270:712-722 pubmed publisher
Wu J, Minikes A, Gao M, Bian H, Li Y, Stockwell B, et al. Intercellular interaction dictates cancer cell ferroptosis via NF2-YAP signalling. Nature. 2019;572:402-406 pubmed publisher
Adams E, Karthaus W, Hoover E, Liu D, Gruet A, Zhang Z, et al. FOXA1 mutations alter pioneering activity, differentiation and prostate cancer phenotypes. Nature. 2019;571:408-412 pubmed publisher
Artegiani B, van Voorthuijsen L, Lindeboom R, Seinstra D, Heo I, Tapia P, et al. Probing the Tumor Suppressor Function of BAP1 in CRISPR-Engineered Human Liver Organoids. Cell Stem Cell. 2019;: pubmed publisher
Cheng W, Tsui Y, Ragusa S, Koelzer V, Mina M, Franco F, et al. Uncoupling protein 2 reprograms the tumor microenvironment to support the anti-tumor immune cycle. Nat Immunol. 2019;20:206-217 pubmed publisher
Hatzi K, Geng H, Doane A, Meydan C, LaRiviere R, Cárdenas M, et al. Histone demethylase LSD1 is required for germinal center formation and BCL6-driven lymphomagenesis. Nat Immunol. 2019;20:86-96 pubmed publisher
Bulatov E, Sayarova R, Mingaleeva R, Miftakhova R, Gomzikova M, Ignatyev Y, et al. Isatin-Schiff base-copper (II) complex induces cell death in p53-positive tumors. Cell Death Discov. 2018;4:103 pubmed publisher
Deng M, Gui X, Kim J, Xie L, Chen W, Li Z, et al. LILRB4 signalling in leukaemia cells mediates T cell suppression and tumour infiltration. Nature. 2018;562:605-609 pubmed publisher
Su H, Hu J, Huang L, Yang Y, Thenoz M, Kuchmiy A, et al. SHQ1 regulation of RNA splicing is required for T-lymphoblastic leukemia cell survival. Nat Commun. 2018;9:4281 pubmed publisher
Vasquez V, Mitra J, Perry G, Rao K, Hegde M. An Inducible Alpha-Synuclein Expressing Neuronal Cell Line Model for Parkinson's Disease1. J Alzheimers Dis. 2018;66:453-460 pubmed publisher
Paluvai H, Di Giorgio E, Brancolini C. Unscheduled HDAC4 repressive activity in human fibroblasts triggers TP53-dependent senescence and favors cell transformation. Mol Oncol. 2018;12:2165-2181 pubmed publisher
Wang H, Qiu Z, Liu B, Wu Y, Ren J, Liu Y, et al. PLK1 targets CtIP to promote microhomology-mediated end joining. Nucleic Acids Res. 2018;46:10724-10739 pubmed publisher
van den Berg J, G Manjón A, Kielbassa K, Feringa F, Freire R, Medema R. A limited number of double-strand DNA breaks is sufficient to delay cell cycle progression. Nucleic Acids Res. 2018;46:10132-10144 pubmed publisher
Wu Y, Zhao W, Liu Y, Tan X, Li X, Zou Q, et al. Function of HNRNPC in breast cancer cells by controlling the dsRNA-induced interferon response. EMBO J. 2018;37: pubmed publisher
Chen Q, Kassab M, Dantzer F, Yu X. PARP2 mediates branched poly ADP-ribosylation in response to DNA damage. Nat Commun. 2018;9:3233 pubmed publisher
Hung P, Johnson B, Chen B, Byrum A, Bredemeyer A, Yewdell W, et al. MRI Is a DNA Damage Response Adaptor during Classical Non-homologous End Joining. Mol Cell. 2018;71:332-342.e8 pubmed publisher
Patil A, Manzano M, Gottwein E. CK1? and IRF4 are essential and independent effectors of immunomodulatory drugs in primary effusion lymphoma. Blood. 2018;132:577-586 pubmed publisher
Phelan J, Young R, Webster D, Roulland S, Wright G, Kasbekar M, et al. A multiprotein supercomplex controlling oncogenic signalling in lymphoma. Nature. 2018;560:387-391 pubmed publisher
Magliozzi R, Carrero Z, Low T, Yuniati L, Valdes Quezada C, Kruiswijk F, et al. Inheritance of the Golgi Apparatus and Cytokinesis Are Controlled by Degradation of GBF1. Cell Rep. 2018;23:3381-3391.e4 pubmed publisher
Li X, Wang X, Song W, Xu H, Huang R, Wang Y, et al. Oncogenic Properties of NEAT1 in Prostate Cancer Cells Depend on the CDC5L-AGRN Transcriptional Regulation Circuit. Cancer Res. 2018;78:4138-4149 pubmed publisher
Wei Z, Yoshihara E, He N, Hah N, Fan W, Pinto A, et al. Vitamin D Switches BAF Complexes to Protect β Cells. Cell. 2018;173:1135-1149.e15 pubmed publisher
Kurata J, Lin R. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA. 2018;24:966-981 pubmed publisher
Kang X, Cui C, Wang C, Wu G, Chen H, Lu Z, et al. CAMKs support development of acute myeloid leukemia. J Hematol Oncol. 2018;11:30 pubmed publisher
Hoshii T, Cifani P, Feng Z, Huang C, Koche R, Chen C, et al. A Non-catalytic Function of SETD1A Regulates Cyclin K and the DNA Damage Response. Cell. 2018;172:1007-1021.e17 pubmed publisher
Hill A, McFaline Figueroa J, Starita L, Gasperini M, Matreyek K, Packer J, et al. On the design of CRISPR-based single-cell molecular screens. Nat Methods. 2018;15:271-274 pubmed publisher
Child S, Hickson S, Bayer A, Malouli D, Fruh K, Geballe A. Antagonism of the Protein Kinase R Pathway in Human Cells by Rhesus Cytomegalovirus. J Virol. 2018;92: pubmed publisher
Qiu S, Leung A, Bo Y, Kozak R, Anand S, Warkentin C, et al. Ebola virus requires phosphatidylinositol (3,5) bisphosphate production for efficient viral entry. Virology. 2018;513:17-28 pubmed publisher
Zhao W, Siegel D, Biton A, Tonqueze O, Zaitlen N, Ahituv N, et al. CRISPR-Cas9-mediated functional dissection of 3'-UTRs. Nucleic Acids Res. 2017;45:10800-10810 pubmed publisher
Sancisi V, Manzotti G, Gugnoni M, Rossi T, Gandolfi G, Gobbi G, et al. RUNX2 expression in thyroid and breast cancer requires the cooperation of three non-redundant enhancers under the control of BRD4 and c-JUN. Nucleic Acids Res. 2017;45:11249-11267 pubmed publisher
Kim D, Dastidar H, Zhang C, Zemp F, Lau K, Ernst M, et al. Smac mimetics and oncolytic viruses synergize in driving anticancer T-cell responses through complementary mechanisms. Nat Commun. 2017;8:344 pubmed publisher
Vasquez V, Mitra J, Hegde P, Pandey A, Sengupta S, Mitra S, et al. Chromatin-Bound Oxidized ?-Synuclein Causes Strand Breaks in Neuronal Genomes in in vitro Models of Parkinson's Disease. J Alzheimers Dis. 2017;60:S133-S150 pubmed publisher
Chen Y, Anastassiadis K, Kranz A, Stewart A, Arndt K, Waskow C, et al. MLL2, Not MLL1, Plays a Major Role in Sustaining MLL-Rearranged Acute Myeloid Leukemia. Cancer Cell. 2017;31:755-770.e6 pubmed publisher
Xia L, Huang W, Bellani M, Seidman M, Wu K, Fan D, et al. CHD4 Has Oncogenic Functions in Initiating and Maintaining Epigenetic Suppression of Multiple Tumor Suppressor Genes. Cancer Cell. 2017;31:653-668.e7 pubmed publisher
Wan L, Wen H, Li Y, Lyu J, Xi Y, Hoshii T, et al. ENL links histone acetylation to oncogenic gene expression in acute myeloid leukaemia. Nature. 2017;543:265-269 pubmed publisher
O Prey J, Sakamaki J, Baudot A, New M, van Acker T, Tooze S, et al. Application of CRISPR/Cas9 to Autophagy Research. Methods Enzymol. 2017;588:79-108 pubmed publisher
Chen J, Cai T, Zheng C, Lin X, Wang G, Liao S, et al. MicroRNA-202 maintains spermatogonial stem cells by inhibiting cell cycle regulators and RNA binding proteins. Nucleic Acids Res. 2017;45:4142-4157 pubmed publisher
Vincent H, Ziehr B, Moorman N. Mechanism of Protein Kinase R Inhibition by Human Cytomegalovirus pTRS1. J Virol. 2017;91: pubmed publisher
Stockman V, Ghamsari L, Lasso G, Honig B, Shapira S, Wang H. A High-Throughput Strategy for Dissecting Mammalian Genetic Interactions. PLoS ONE. 2016;11:e0167617 pubmed publisher
Hung P, Chen B, George R, Liberman C, Morales A, Colon Ortiz P, et al. Deficiency of XLF and PAXX prevents DNA double-strand break repair by non-homologous end joining in lymphocytes. Cell Cycle. 2017;16:286-295 pubmed publisher
Hanč P, Schulz O, Fischbach H, Martin S, Kjær S, Reis E Sousa C. A pH- and ionic strength-dependent conformational change in the neck region regulates DNGR-1 function in dendritic cells. EMBO J. 2016;35:2484-2497 pubmed
Munehira Y, Yang Z, Gozani O. Systematic Analysis of Known and Candidate Lysine Demethylases in the Regulation of Myoblast Differentiation. J Mol Biol. 2017;429:2055-2065 pubmed publisher
Luo C, Lim J, Lee Y, Granter S, Thomas A, Vazquez F, et al. A PGC1?-mediated transcriptional axis suppresses melanoma metastasis. Nature. 2016;537:422-426 pubmed publisher
Feringa F, Krenning L, Koch A, van den Berg J, van den Broek B, Jalink K, et al. Hypersensitivity to DNA damage in antephase as a safeguard for genome stability. Nat Commun. 2016;7:12618 pubmed publisher
Liu G, Liu K, Wei H, Li L, Zhang S. Generation of porcine fetal fibroblasts expressing the tetracycline-inducible Cas9 gene by somatic cell nuclear transfer. Mol Med Rep. 2016;14:2527-33 pubmed publisher
Tang K, CONSTANZO J, Venkateswaran N, Melegari M, Ilcheva M, Morales J, et al. Focal Adhesion Kinase Regulates the DNA Damage Response and Its Inhibition Radiosensitizes Mutant KRAS Lung Cancer. Clin Cancer Res. 2016;22:5851-5863 pubmed
Miyagawa T, Ebinuma I, Morohashi Y, Hori Y, Young Chang M, Hattori H, et al. BIN1 regulates BACE1 intracellular trafficking and amyloid-? production. Hum Mol Genet. 2016;25:2948-2958 pubmed
Uddin B, Chen N, Panic M, Schiebel E. Genome editing through large insertion leads to the skipping of targeted exon. BMC Genomics. 2015;16:1082 pubmed publisher
Saito Y, Chapple R, Lin A, Kitano A, Nakada D. AMPK Protects Leukemia-Initiating Cells in Myeloid Leukemias from Metabolic Stress in the Bone Marrow. Cell Stem Cell. 2015;17:585-96 pubmed publisher
Wollebo H, Bellizzi A, Kaminski R, Hu W, White M, Khalili K. CRISPR/Cas9 System as an Agent for Eliminating Polyomavirus JC Infection. PLoS ONE. 2015;10:e0136046 pubmed publisher
Abrahimi P, Chang W, Kluger M, Qyang Y, Tellides G, Saltzman W, et al. Efficient gene disruption in cultured primary human endothelial cells by CRISPR/Cas9. Circ Res. 2015;117:121-8 pubmed publisher
Wang T, Wei J, Sabatini D, Lander E. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014;343:80-4 pubmed publisher
product information
Catalog Number :
50661
Product Name :
pCW-Cas9
article :
doi10.1126/science.1246981
id7763
pubmed_id24336569
bacterial resistance :
Ampicillin
cloning :
backbonepCW57.1
backbone_mutation
backbone_origin
backbone_size7600
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
CRISPR
growth notes :
Depositors used delta-VPR and CMV VSV-G packaging plasmids
growth strain :
Doxycycline-inducible lentiviral expression of SpCas9
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3BamHI
cloning_site_5NheI
promoterTet ON
sequencing_primer_3CACATTCTTCACGTCCGTTC
sequencing_primer_5AGCTCGTTTAGTGAACCGTCAGATC
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namehumanized S. pyogenes Cas9
shRNA_sequence
size4300
species
tags
locationN terminal on insert
tag3xFLAG
plasmid copy :
human codon optimized 3XFLAG-SpCas9 was cloned from Plasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9
resistance markers :
1808
432
tags :
Unknown
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA