This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pRKVSV-PTEN
catalog :
50538
product information
Catalog Number :
50538
Product Name :
pRKVSV-PTEN
article :
doi
id7644
pubmed_id
bacterial resistance :
Ampicillin
cloning :
backbonepRKVSV
backbone_mutation
backbone_originPMID 14729064
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
origin :
37
pi :
alt_names
MMAC1
tumor suppressor, phosphatase, mutated
cloning
clone_methodRestriction Enzyme
cloning_site_3XbaI
cloning_site_5HindIII
promoterCMV
sequencing_primer_3GFP ASO (TTGTAACCATTATAAGCTGC)
sequencing_primer_5pRK KZ FW (TAGAATAACATCCACTTTGCC)
site_3_destroyed
site_5_destroyed
entrez_gene
aliases10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1
genePTEN
id5728
genbank_ids
mutation
namePTEN
shRNA_sequence
size
species
9606
Homo sapiens
tags
locationN terminal on backbone
tag2X VSV
resistance markers :
1793
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA