This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
FN 221
catalog :
50498
product information
Catalog Number :
50498
Product Name :
FN 221
article :
doi
id7644
pubmed_id
bacterial resistance :
Ampicillin
cloning :
backbonepRSETC'
backbone_mutation
backbone_originInvitrogen
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
origin :
37
pi :
alt_names
FN1
FN type III repeats 6-10, C to A mutation in III-7, KGE in III-10
cloning
clone_methodRestriction Enzyme
cloning_site_3NsiI
cloning_site_5NdeI
promoterT7
sequencing_primer_3
sequencing_primer_5RSET FW (AATACGACTCACTATAGGGAG)
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesCIG, ED-B, FINC, FN, FNZ, GFND, GFND2, LETS, MSF, SMDCF
geneFN1
id2335
genbank_ids
mutationrepeats 6-10, R1524K, D1526E, C1232A
namefibronectin
shRNA_sequence
size
species
9606
Homo sapiens
tags
locationN terminal on backbone
tag6X-His
resistance markers :
1793
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA