This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pAAV-hSyn-hM3D(Gq)-mCherry
catalog :
50474
citations: 31
Reference
Moura D, Parvathaneni A, Sahagun A, Noguchi H, Garcia J, Brennan E, et al. Neuronal Activity Changes the Number of Neurons That Are Synaptically Connected to OPCs. Eneuro. 2023;10: pubmed publisher
Huang Hobbs E, Cheng Y, Ko Y, Luna Figueroa E, Lozzi B, Taylor K, et al. Remote neuronal activity drives glioma progression through SEMA4F. Nature. 2023;619:844-850 pubmed publisher
Sardar D, Cheng Y, Woo J, Choi D, Lee Z, Kwon W, et al. Induction of astrocytic Slc22a3 regulates sensory processing through histone serotonylation. Science. 2023;380:eade0027 pubmed publisher
Varadarajan S, Wang F, Dhande O, Le P, Duan X, Huberman A. Postsynaptic neuronal activity promotes regeneration of retinal axons. Cell Rep. 2023;42:112476 pubmed publisher
Forero S, Sailer L, Gir x10d yt x117 A, Madrid J, Sullivan N, Ophir A. Motherhood and DREADD manipulation of the nucleus accumbens weaken established pair bonds in female prairie voles. Horm Behav. 2023;151:105351 pubmed publisher
Maamrah B, Pocsai K, Bayasgalan T, Csemer A, P xe1 l B. KCNQ4 potassium channel subunit deletion leads to exaggerated acoustic startle reflex in mice. Neuroreport. 2023;34:232-237 pubmed publisher
Nebeling F, Poll S, Justus L, Steffen J, Keppler K, Mittag M, et al. Microglial motility is modulated by neuronal activity and correlates with dendritic spine plasticity in the hippocampus of awake mice. elife. 2023;12: pubmed publisher
Sailer L, Park A, Galvez A, Ophir A. Lateral septum DREADD activation alters male prairie vole prosocial and antisocial behaviors, not partner preferences. Commun Biol. 2022;5:1299 pubmed publisher
Jeon Y, Park J, Jang Y, Kim D, Choi B, Kim J, et al. Chemogenetic modulation of the medial prefrontal cortex regulates resistance to acute stress-induced cognitive impairments. Cereb Cortex. 2022;: pubmed publisher
Keller D, L xe1 ng T, Cserven xe1 k M, Puska G, Barna J, Csillag V, et al. A thalamo-preoptic pathway promotes social grooming in rodents. Curr Biol. 2022;32:4593-4606.e8 pubmed publisher
Ago K, Nagoshi N, Imaizumi K, Kitagawa T, Kawai M, Kajikawa K, et al. A non-invasive system to monitor in vivo neural graft activity after spinal cord injury. Commun Biol. 2022;5:803 pubmed publisher
Hong J, Jeong Y, Heo W. The Neurotrophic Receptor Tyrosine Kinase in MEC-mPFC Neurons Contributes to Remote Memory Consolidation. J Neurosci. 2022;42:6605-19 pubmed publisher
Jiménez González M, Li R, Pomeranz L, Alvarsson A, Marongiu R, Hampton R, et al. Mapping and targeted viral activation of pancreatic nerves in mice reveal their roles in the regulation of glucose metabolism. Nat Biomed Eng. 2022;6:1298-1316 pubmed publisher
Patton A, Smyllie N, Chesham J, Hastings M. Astrocytes sustain circadian oscillation and bidirectionally determine circadian period, but do not regulate circadian phase in the suprachiasmatic nucleus. J Neurosci. 2022;: pubmed publisher
Nentwig T, Obray J, Vaughan D, Chandler L. Behavioral and slice electrophysiological assessment of DREADD ligand, deschloroclozapine (DCZ) in rats. Sci Rep. 2022;12:6595 pubmed publisher
Zhao Q, Yu C, Wang R, Xu Q, Dai Pra R, Zhang L, et al. A multidimensional coding architecture of the vagal interoceptive system. Nature. 2022;603:878-884 pubmed publisher
Kim J, Park D, Seo N, Yoon T, Kim G, Lee S, et al. LRRTM3 regulates activity-dependent synchronization of synapse properties in topographically connected hippocampal neural circuits. Proc Natl Acad Sci U S A. 2022;119: pubmed publisher
Lee E, Park J, Kwon H, Han P. Repeated exposure with short-term behavioral stress resolves pre-existing stress-induced depressive-like behavior in mice. Nat Commun. 2021;12:6682 pubmed publisher
Jiang C, Yang X, He G, Wang F, Wang Z, Xu W, et al. CRHCeA→VTA inputs inhibit the positive ensembles to induce negative effect of opiate withdrawal. Mol Psychiatry. 2021;: pubmed publisher
Zhu M, Kasaragod D, Kikutani K, Taguchi K, Aizawa H. A Novel Microcontroller-Based System for the Wheel-Running Activity in Mice. Eneuro. 2021;8: pubmed publisher
Ibrahim L, Huang S, Fernández Otero M, Sherer M, Qiu Y, Vemuri S, et al. Bottom-up inputs are required for establishment of top-down connectivity onto cortical layer 1 neurogliaform cells. Neuron. 2021;109:3473-3485.e5 pubmed publisher
Barik A, Sathyamurthy A, Thompson J, Seltzer M, LEVINE A, Chesler A. A spinoparabrachial circuit defined by Tacr1 expression drives pain. elife. 2021;10: pubmed publisher
Townsley K, Borrego M, OZBURN A. Effects of chemogenetic manipulation of the nucleus accumbens core in male C57BL/6J mice. Alcohol. 2020;91:21-27 pubmed publisher
Khademullah C, Aqrabawi A, Place K, Dargaei Z, Liang X, Pressey J, et al. Cortical interneuron-mediated inhibition delays the onset of amyotrophic lateral sclerosis. Brain. 2020;143:800-810 pubmed publisher
Guerin K, Rego M, Bourges D, Ersing I, Haery L, Harten DeMaio K, et al. A Novel Next-Generation Sequencing and Analysis Platform to Assess the Identity of Recombinant Adeno-Associated Viral Preparations from Viral DNA Extracts. Hum Gene Ther. 2020;31:664-678 pubmed publisher
Bonaventura J, Eldridge M, Hu F, Gomez J, Sánchez Soto M, Abramyan A, et al. High-potency ligands for DREADD imaging and activation in rodents and monkeys. Nat Commun. 2019;10:4627 pubmed publisher
Teissier A, Le Magueresse C, Olusakin J, Andrade da Costa B, De Stasi A, Bacci A, et al. Early-life stress impairs postnatal oligodendrogenesis and adult emotional behaviour through activity-dependent mechanisms. Mol Psychiatry. 2020;25:1159-1174 pubmed publisher
Rao S, Chen R, LaRocca A, Christiansen M, Senko A, Shi C, et al. Remotely controlled chemomagnetic modulation of targeted neural circuits. Nat Nanotechnol. 2019;14:967-973 pubmed publisher
Kakava Georgiadou N, Bullich Vilarrubias C, Zwartkruis M, Luijendijk M, Garner K, Adan R. Considerations related to the use of short neuropeptide promoters in viral vectors targeting hypothalamic neurons. Sci Rep. 2019;9:11146 pubmed publisher
Beroun A, Nalberczak Skóra M, Harda Z, Piechota M, Ziołkowska M, Cały A, et al. Generation of silent synapses in dentate gyrus correlates with development of alcohol addiction. Neuropsychopharmacology. 2018;43:1989-1999 pubmed publisher
Ryan P, Ross S, Campos C, Derkach V, Palmiter R. Oxytocin-receptor-expressing neurons in the parabrachial nucleus regulate fluid intake. Nat Neurosci. 2017;20:1722-1733 pubmed publisher
product information
Catalog Number :
50474
Product Name :
pAAV-hSyn-hM3D(Gq)-mCherry
article :
doi
id7641
pubmed_id
bacterial resistance :
Ampicillin
cloning :
backbonepAAV
backbone_mutation
backbone_origin
backbone_size4818
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
AAV
growth notes :
Please Note- This plasmid does NOT contain an N-terminal HA tag. These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
growth strain :
Gq-coupled hM3D DREADD fused with mCherry under the control of human synapsin promoter
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoR I
cloning_site_5Sal I
promoterhuman Synapsin 1
sequencing_primer_3GCATTAAAGCAGCGTATCCACATAGC
sequencing_primer_5TCGTGTCGTGCCTGAGAGCG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesEGBRS, HM3, PBS, m3AChR
geneCHRM3
id1131
genbank_ids
mutationSee supplemental documents for DREADD mutations
namehM3D(Gq)-mCherry
shRNA_sequence
size2502
species
9606
Homo sapiens
tags
locationC terminal on insert
tagmCherry
resistance markers :
1493
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA