This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pSpCas9 (PX165)
catalog :
48137
citations: 28
Reference
Fuentes L, Marin Z, Tyson J, Baddeley D, Bewersdorf J. The nanoscale organization of reticulon 4 shapes local endoplasmic reticulum structure in situ. J Cell Biol. 2023;222: pubmed publisher
Zhang H, Wang X, Qu M, Li Z, Yin X, Tang L, et al. Foot-and-mouth disease virus structural protein VP3 interacts with HDAC8 and promotes its autophagic degradation to facilitate viral replication. Autophagy. 2023;:1-15 pubmed publisher
Smidler A, Paton D, Church G, Esvelt K, Shaw W, Catteruccia F. CRISPR-mediated germline mutagenesis for genetic sterilization of Anopheles gambiae males. bioRxiv. 2023;: pubmed publisher
Zhang Y, Yang J, Yao H, Zhang Z, Song Y. CRISPR/Cas9-mediated deletion of Fam83h induces defective tooth mineralization and hair development in rabbits. J Cell Mol Med. 2022;26:5670-5679 pubmed publisher
Liu X, Cui S, Qi Q, Lei H, Zhang Y, Shen W, et al. G-quadruplex-guided RNA engineering to modulate CRISPR-based genomic regulation. Nucleic Acids Res. 2022;50:11387-11400 pubmed publisher
Liu X, Xiong W, Qi Q, Zhang Y, Ji H, Cui S, et al. Rational guide RNA engineering for small-molecule control of CRISPR/Cas9 and gene editing. Nucleic Acids Res. 2022;: pubmed publisher
Lohraseb I, McCarthy P, Secker G, Marchant C, Wu J, Ali N, et al. Global ubiquitinome profiling identifies NEDD4 as a regulator of Profilin 1 and actin remodelling in neural crest cells. Nat Commun. 2022;13:2018 pubmed publisher
Steinecke A, Bolton M, Taniguchi H. Neuromodulatory control of inhibitory network arborization in the developing postnatal neocortex. Sci Adv. 2022;8:eabe7192 pubmed publisher
Ishiguro S, Yachie N. Highly Multiplexed Analysis of CRISPR Genome Editing Outcomes in Mammalian Cells. Methods Mol Biol. 2021;2312:193-223 pubmed publisher
Willy N, Colombo F, Huber S, Smith A, Norton E, Kural C, et al. CALM supports clathrin-coated vesicle completion upon membrane tension increase. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Wang Q, Gavin W, Masiello N, Tran K, Laible G, Shepherd P. Cetuximab produced from a goat mammary gland expression system is equally efficacious as innovator cetuximab in animal cancer models. Biotechnol Rep (Amst). 2020;28:e00533 pubmed publisher
Schmid Burgk J, Gao L, Li D, Gardner Z, Strecker J, Lash B, et al. Highly Parallel Profiling of Cas9 Variant Specificity. Mol Cell. 2020;78:794-800.e8 pubmed publisher
Xu Y, Liu H, Pan H, Wang X, Zhang Y, Yao B, et al. CRISPR/Cas9-mediated Disruption of Fibroblast Growth Factor 5 in Rabbits Results in a Systemic Long Hair Phenotype by Prolonging Anagen. Genes (Basel). 2020;11: pubmed publisher
Hardy L, Pergande M, Esparza K, Heath K, Onyuksel H, Cologna S, et al. Proteomic analysis reveals a role for PAX8 in peritoneal colonization of high grade serous ovarian cancer that can be targeted with micelle encapsulated thiostrepton. Oncogene. 2019;38:6003-6016 pubmed publisher
Steinecke A, Kurabayashi N, Hayano Y, Ishino Y, Taniguchi H. In Vivo Single-Cell Genotyping of Mouse Cortical Neurons Transfected with CRISPR/Cas9. Cell Rep. 2019;28:325-331.e4 pubmed publisher
Schroeder L, Barentine A, Merta H, Schweighofer S, Zhang Y, Baddeley D, et al. Dynamic nanoscale morphology of the ER surveyed by STED microscopy. J Cell Biol. 2019;218:83-96 pubmed publisher
Izmiryan A, Ganier C, Bovolenta M, Schmitt A, Mavilio F, Hovnanian A. Ex Vivo COL7A1 Correction for Recessive Dystrophic Epidermolysis Bullosa Using CRISPR/Cas9 and Homology-Directed Repair. Mol Ther Nucleic Acids. 2018;12:554-567 pubmed publisher
Deng J, Chen M, Liu Z, Song Y, Sui T, Lai L, et al. The disrupted balance between hair follicles and sebaceous glands in Hoxc13-ablated rabbits. FASEB J. 2019;33:1226-1234 pubmed publisher
Xu Y, Wang Y, Song Y, Deng J, Chen M, Ouyang H, et al. Generation and Phenotype Identification of PAX4 Gene Knockout Rabbit by CRISPR/Cas9 System. G3 (Bethesda). 2018;8:2833-2840 pubmed publisher
Sui T, Lau Y, Liu D, Liu T, Xu L, Gao Y, et al. A novel rabbit model of Duchenne muscular dystrophy generated by CRISPR/Cas9. Dis Model Mech. 2018;11: pubmed publisher
Sui T, Xu L, Lau Y, Liu D, Liu T, Gao Y, et al. Development of muscular dystrophy in a CRISPR-engineered mutant rabbit model with frame-disrupting ANO5 mutations. Cell Death Dis. 2018;9:609 pubmed publisher
Liu H, Sui T, Liu D, Liu T, Chen M, Deng J, et al. Multiple homologous genes knockout (KO) by CRISPR/Cas9 system in rabbit. Gene. 2018;647:261-267 pubmed publisher
Guzzardo P, Rashkova C, Dos Santos R, Tehrani R, Collin P, Burckstummer T. A small cassette enables conditional gene inactivation by CRISPR/Cas9. Sci Rep. 2017;7:16770 pubmed publisher
Ade C, Derbes R, Wagstaff B, Linker S, White T, Deharo D, et al. Evaluating different DNA binding domains to modulate L1 ORF2p-driven site-specific retrotransposition events in human cells. Gene. 2018;642:188-198 pubmed publisher
Song Y, Xu Y, Deng J, Chen M, Lu Y, Wang Y, et al. CRISPR/Cas9-mediated mutation of tyrosinase (Tyr) 3' UTR induce graying in rabbit. Sci Rep. 2017;7:1569 pubmed publisher
Lv Q, Yuan L, Deng J, Chen M, Wang Y, Zeng J, et al. Efficient Generation of Myostatin Gene Mutated Rabbit by CRISPR/Cas9. Sci Rep. 2016;6:25029 pubmed publisher
Yuan L, Sui T, Chen M, Deng J, Huang Y, Zeng J, et al. CRISPR/Cas9-mediated GJA8 knockout in rabbits recapitulates human congenital cataracts. Sci Rep. 2016;6:22024 pubmed publisher
Ran F, Hsu P, Wright J, Agarwala V, Scott D, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8:2281-2308 pubmed publisher
product information
Catalog Number :
48137
Product Name :
pSpCas9 (PX165)
article :
doi10.1038/nprot.2013.143
id7475
pubmed_id24157548
bacterial resistance :
Ampicillin
cloning :
backbonePX165
backbone_mutation
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
CRISPR
growth notes :
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.
growth strain :
Human codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS)
origin :
37
pi :
alt_names
SpCas9
Cas9
PX165
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5AgeI
promoterCbh
sequencing_primer_3
sequencing_primer_5CTGGAGCACCTGCCTGAAATCACT
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namehSpCas9
shRNA_sequence
size5400
species
100
Synthetic
tags
locationN terminal on insert
tag3XFLAG
resistance markers :
898
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA