This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pVC297 VEGF Site#1
catalog :
47505
citations: 2
| Reference |
|---|
product information
Catalog Number :
47505
Product Name :
pVC297 VEGF Site#1
article :
| doi | 10.1038/nbt.2623 |
| id | 7091 |
| pubmed_id | 23792628 |
bacterial resistance :
Ampicillin
cloning :
| backbone | MLM3636 | ||
| backbone_mutation | |||
| backbone_origin | Joung lab (Addgene plasmid #43860) | ||
| backbone_size | 2278 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
Target site: GGGTGGGGGGAGTTTGCTCC gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9) For more information on Joung Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/jounglab/
growth strain :
human gRNA expression vector targeting VEGF
origin :
37
pi :
|
resistance markers :
| 236 |
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
