This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pU6-sgCXCR4-2
catalog :
46917
citations: 4
| Reference |
|---|
product information
Catalog Number :
46917
Product Name :
pU6-sgCXCR4-2
article :
| doi | 10.1016/j.cell.2013.06.044 |
| id | 7026 |
| pubmed_id | 23849981 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pSICO derivative | |||
| backbone_mutation | ||||
| backbone_origin | Addgene | |||
| backbone_size | 8200 | |||
| promoter | ||||
| sequencing_primer_3 | ||||
| sequencing_primer_5 | ||||
| vector_types |
|
growth notes :
gRNA target sequence GCAGGTAGCAAAGTGACGCCGA For more information on Qi and Wiessman Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Qi-weissman/ and http://www.addgene.org/crispr/qi/
growth strain :
Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CXCR4 gene
origin :
37
pi :
| ||||||||||||||||||||||||||||||||||||||||||||||
|
resistance markers :
| 1487 |
| 1648 |
tags :
Low Copy
terms :
| Puromycin |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
