This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pFA12
catalog :
46792
citations: 1
product information
Catalog Number :
46792
Product Name :
pFA12
article :
doi | 10.1371/journal.pone.0008111 |
id | 6956 |
pubmed_id | 19956593 |
bacterial resistance :
Ampicillin
cloning :
backbone | pYES2.1/V5-His/lacZ | |
backbone_mutation | The vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA1 contains the full-length wild-type Fun30 sequence. The coding region of Fun30, including the 2 codons immediately upstream of the sequence and excluding the stop codon were amplified by polymerase chain reaction (PCR) from purified genomic DNA using the enzyme PfuUltra (Stratagene) following the manufacturer s specifications. The primers used were: forward F30 (GTCGACGAAAACATGAGTGGTTCG) and reverse F30 (CTCGAGTTCTTTGGTTCCCTTCGG), which introduced a SalI and an XhoI restriction enzyme sites in the fragment amplified, in the 5 - and 3 - ends, respectively. 3 adenylation of the amplified fragments was done by PCR, after which the TOPO cloning reaction was performed. PFA12 contains a version of Fun30 in which the residues that have been shown to bind ubiquitin in the Cue domain (Donaldson et al., 2003; Shih et al., 2003) have been mutated: phenylalanine at position 82 (TTC) and proline at position 83 (CCC) have both been replaced by residues of alanine (GCC). The point mutations were introduced with the kit QuickChange XL Site-Directed Mutagenesis (Stratagene), according to the manufacturer s specifications. The template was PFA1 and the primers were Forward PMut Cue (GTTAACCTTGCGAGAGAGGCCGCCGATTTCTCTCAAAC) and Reverse PMut Cue (GTTTGAGAGAAATCGGCGGCCTCTCTCGCAAGGTTAAC). | |
backbone_origin | Invitrogen | |
backbone_size | 8964 | |
promoter | ||
sequencing_primer_3 | ||
sequencing_primer_5 | ||
vector_types |
|
growth strain :
To express a version of Fun30 with a mutated CUE domain in budding yeast
origin :
37
pi :
|
resistance markers :
1634 |
tags :
Unknown
terms :
URA3 |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments