This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pFA1
catalog :
46789
citations: 1
product information
Catalog Number :
46789
Product Name :
pFA1
article :
| doi | 10.1371/journal.pone.0008111 |
| id | 6956 |
| pubmed_id | 19956593 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pYES2.1/V5-His/lacZ | |
| backbone_mutation | The vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA1 contains the full-length wild-type Fun30 sequence. The coding region of Fun30, including the 2 codons immediately upstream of the sequence and excluding the stop codon were amplified by polymerase chain reaction (PCR) from purified genomic DNA using the enzyme PfuUltra (Stratagene) following the manufacturer s specifications. The primers used were: forward F30 (GTCGACGAAAACATGAGTGGTTCG) and reverse F30 (CTCGAGTTCTTTGGTTCCCTTCGG), which introduced a SalI and an XhoI restriction enzyme sites in the fragment amplified, in the 5 - and 3 - ends, respectively. 3 adenylation of the amplified fragments was done by PCR, after which the TOPO cloning reaction was performed. | |
| backbone_origin | Invitrogen | |
| backbone_size | 8964 | |
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth strain :
To express Fun30 in trans in budding yeast
origin :
37
pi :
|
resistance markers :
| 1634 |
tags :
Unknown
terms :
| URA3 |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments