This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pT7tyrgRNA
catalog :
46761
citations: 3
| Reference |
|---|
product information
Catalog Number :
46761
Product Name :
pT7tyrgRNA
article :
| doi | 10.1073/pnas.1308335110 |
| id | 7188 |
| pubmed_id | 23918387 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pT7-gRNA | |
| backbone_mutation | ||
| backbone_origin | ||
| backbone_size | 2542 | |
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth notes :
For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence CCCCAGAAGTCCTCCAGTCC
origin :
37
pi :
|
resistance markers :
| 1611 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
