This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCRII-Topo Hspb3 in situ probe
catalog :
45629
citations: 1
product information
Catalog Number :
45629
Product Name :
pCRII-Topo Hspb3 in situ probe
article :
| doi | 10.1523/JNEUROSCI.6108-08.2009 |
| id | 6757 |
| pubmed_id | 19793993 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pCRII-Topo | ||
| backbone_mutation | |||
| backbone_origin | Invitrogen | ||
| backbone_size | 4000 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
The Hspb3 fragment was amplified by RT-PCR using the following primer pair: TGATTCAGCCCCAATTAAGC CTGGGGTATGAAGAGCAACC For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.
origin :
37
pi :
|
resistance markers :
| 1573 |
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
