This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCRII-Topo Tcrb-V13 in situ probe
catalog :
45622
citations: 1
Reference |
---|
Molyneaux B, Arlotta P, Hirata T, Hibi M, Macklis J. Fezl is required for the birth and specification of corticospinal motor neurons. Neuron. 2005;47:817-31 pubmed
|
product information
Catalog Number :
45622
Product Name :
pCRII-Topo Tcrb-V13 in situ probe
article :
doi | 10.1016/j.neuron.2005.08.030 |
id | 6756 |
pubmed_id | 16157277 |
bacterial resistance :
Ampicillin
cloning :
backbone | pCRII-Topo | ||
backbone_mutation | |||
backbone_origin | Invitrogen | ||
backbone_size | 4000 | ||
promoter | |||
sequencing_primer_3 | |||
sequencing_primer_5 | |||
vector_types |
|
growth notes :
The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair: CTGAGCTGGTGGGTGAATG AAGGTGTCAACGAGGAAGGA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication.
origin :
37
pi :
|
resistance markers :
1573 |
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments